전체메뉴
Advanced Search +

JMB Journal of Microbiolog and Biotechnology

QR Code QR Code

Research article

Environmental Microbiology and Biotechnology (EMB)  |  Biodegradation and Bioremediation

Kraft Lignin Decomposition by Forest Soil Bacterium Pseudomonas kribbensis CHA-19

Dockyu Kim1,2*, Han-Woo Kim1,2*, and Hyoungseok Lee1,2

1Division of Life Sciences, Korea Polar Research Institute, Incheon 21990, Republic of Korea
2Department of Polar Sciences, University of Science and Technology, Incheon 21990, Republic of Korea

Correspondence to:
D Kim,          envimic@kopri.re.kr
HW Kim,       hwkim@kopri.re.kr
Received: June 11, 2024; Revised: June 27, 2024; Accepted: July 5, 2024

J. Microbiol. Biotechnol. 2024; 34(9): 1867-1875

Published September 28, 2024 https://doi.org/10.4014/jmb.2406.06021

Copyright © The Korean Society for Microbiology and Biotechnology.

Abstract

Identification of the biochemical metabolic pathway for lignin decomposition and the responsible degradative enzymes is needed for the effective biotechnological valorization of lignin to renewable chemical products. In this study, we investigated the decomposition of kraft lignin by the soil bacterium Pseudomonas kribbensis CHA-19, a strain that can utilize kraft lignin and its main degradation metabolite, vanillic acid, as growth substrates. Gel permeation chromatography revealed that CHA-19 decomposed polymeric lignin and degraded dehydrodivanillin (a representative lignin model compound); however, the degradative enzyme(s) and mechanism were not identified. Quantitative polymerase chain reaction with mRNAs from CHA-19 cells induced in the presence of lignin showed that the putative genes coding for two laccase-like multicopper oxidases (LMCOs) and three dye-decolorizing peroxidases (DyPs) were upregulated by 2.0- to 7.9-fold compared with glucose-induced cells, which indicates possible cooperation with multiple enzymes for lignin decomposition. Computational homology analysis of the protein sequences of LMCOs and DyPs also predicted their roles in lignin decomposition. Based on the above data, CHA-19 appears to initiate oxidative lignin decomposition using multifunctional LMCOs and DyPs, producing smaller metabolites such as vanillic acid, which is further degraded via ortho- and meta-ring cleavage pathways. This study not only helps to better understand the role of bacteria in lignin decomposition and thus in terrestrial ecosystems, but also expands the biocatalytic toolbox with new bacterial cells and their degradative enzymes for lignin valorization.

Keywords

Bacterial peroxidase, bacterial laccase, biocatalyst, biodegradation, kraft lignin, Pseudomonas

Graphical Abstract


Introduction

Lignocellulose is composed of cellulose, hemicellulose, and lignin, and is the largest organic polymer reservoir in the ecosystem. As a major component (15%–30%) of lignocellulosic biomass, lignin is a complex and heterogeneous aromatic polymer found in the cell walls of plants and has the potential to be a valuable resource for producing renewable chemicals [1]. Ongoing research into the extraction and modification of lignin for various applications contributes to the development of more sustainable and environmentally friendly technologies. Lignin is a byproduct (approximately 50 million tons annually) of the pulp and paper industry, which in combination with commercial cellulosic ethanol production helps provide an oversupply of lignin [2]. Therefore, lignin has gained attention owing to its potential industrial applications in producing biofuels, adhesives, and other value-added chemicals.

Lignin valorization refers to the extraction of compounds such as vanillin, flavor, and other value-added chemicals [3] from lignin, and is thus considered a key process in the successful development of lignocellulosic biorefineries. Several strategies have emerged for lignin valorization, including chemical, biological, and thermochemical processes, which are necessary for taking full advantage of lignin’s potential as a natural resource. However, owing to its polymeric structural complexity and high molecular weight, lignin is insoluble in water and resistant to microbial and enzymatic degradation, making lignin breakdown a challenging task. Biological conversion processes using microbial cells (bacteria or fungi) or their extracellular enzymes can break down lignin into simpler molecules and valuable products such as biofuels or bioplastics [4].

Soil fungal basidiomycetes, especially white-rot fungi, have been well characterized to oxidatively decompose lignin using extracellular lignin peroxidases, laccases, and manganese peroxidases, which can break down the complex structure of lignin. The resulting small aromatic and aliphatic compounds are completely degraded by the surrounding bacteria. For example, vanillic acid, the main aromatic metabolite resulting from enzymatic lignin cleavage [5], is converted to protocatechuate, which is further degraded via ortho and/or meta cleavage pathways. Many lignin-degrading bacteria in several genera (Rhodococcus, Amycolatopsis, Pseudomonas, Ochrobactrum, Bacillus, and Streptomyces) were isolated from various natural and industrial environments [6]. From them, peroxidases [7], dye-decolorizing peroxidases (DyPs) [8-10], laccases [11], laccase-like enzymes [1, 12, 13], multicopper oxidases (MCOs) [14], and β-etherases [15, 16] have been detected and assumed to cleave C–C and C–O–C linkages within lignin. Although fungal ligninolytic capability is much higher than that of bacteria, some bacterial strains can be explored for lignin valorization because of their rapid growth, easy genetic manipulation, and metabolic versatility with diverse catalytic enzyme systems and pathways. Particularly, bacterial laccases are more thermostable and resistant to harsh conditions (alkali pH and salinity), and their overproduction of recombinant enzymes is accomplished relatively easier than with their fungal counterparts [1]. Therefore, the bacterial strains with higher ligninolytic capability and efficient bioconversion systems are prerequisite for successful lignin valorization [6].

Here, we aimed to characterize a potential lignin-degrading bacterium isolated from forest organic soil that exhibited rapid growth in a medium containing kraft lignin as the sole carbon source. The lignin-degrading capability of the isolate was determined physiologically and spectrophotometrically, and its putative ligninolytic enzymes (DyPs and LMCOs) responsible for the initial lignin decomposition were analyzed using mRNA-targeted quantitative polymerase chain reaction (PCR) and computer-aided functional prediction methods. This bacterial isolate is valuable for lignin valorization because of its growth capability, decomposition activity, and cooperative reaction between multiple ligninolytic enzymes.

Materials and Methods

Growth Test on Polymeric Lignin and Lignin Metabolite

Pseudomonas kribbensis CHA-19 (KCTC 72262) was previously isolated from forest organic soil in New Jersey, USA, owing to its ability to degrade polymeric humic acids (HA). The draft genome sequence of strain CHA-19 was analyzed to identify the genes involved in HA decomposition, and its HA-degradative pathway was proposed previously [17]. CHA-19 was inoculated into mineral salts basal (MSB) broth containing 20 mM glucose (MSB+Glu) and incubated at 28°C for 2 days with shaking. After culturing, the glucose adhering to the cell surface and remaining in the culture medium was removed by centrifuging (8,000 ×g for 20 min) and washing the cell pellet with new MSB broth. The cell suspension in MSB was transferred to 50 ml of fresh MSB in an Erlenmeyer flask (250 ml) at an absorbance at 600 nm of 0.1. Kraft lignin (Sigma-Aldrich, cat. no. 370959, USA) and vanillic acid (Sigma-Aldrich, cat. no. H36001) were completely dissolved in 1.0 N NaOH (10% stock solution) and distilled water with a small amount of NaOH (250 mM stock solution), respectively, and added to a flask at final concentrations of 0.05% (lignin) and 3 mM (vanillic acid). During culturing at 28°C for 25 days, at indicated time intervals, 100 μl of the culture was diluted in MSB, and 100 μl of this dilution was plated on MSB+Glu. After incubation at 28°C, the number of colony-forming units (CFU) per milliliter was calculated.

Decomposition of Polymeric Lignin

Strain CHA-19 was grown in 80 ml MSB+Glu at 28°C for 3 days with shaking, and the cells were harvested by centrifugation (8,000 ×g for 20 min). The pellet was resuspended in 40 ml MSB and transferred to an Erlenmeyer flask (250 ml). Kraft lignin was then added to the flask at a final concentration of 0.05%. The control was prepared without the inoculation of the cell pellet. The flasks were incubated with shaking at 28°C, and the structural changes in lignin owing to the decomposition activity of CHA-19 were analyzed by gel permeation chromatography (GPC), as described below.

After 15 days of incubation, a small portion (1.0 ml) of the culture was centrifuged (10,000 ×g for 10 min). The supernatant was filtered through a hydrophilic membrane (0.2 μm), and the filtrate (20.0 μl, 0.5 mg of lignin/ml) was separated using Shodex OHpak SB-G 6B guard (6.0 mm ID × 50 mm length), SB-804 HQ (8.0 × 300 mm), and SB-805 HQ (8.0 × 300 mm) columns tandemly connected to an Agilent Technology 1200 HPLC (high-performance liquid chromatography) System. The flow rate of the mobile phase (degassed water) was 0.5 ml/min, and the GPC eluates were examined with a refractive index detector. A set of Shodex standard pullulan samples (kit P-82; 9,600–642,000 Da) was used as the molecular weight reference.

Degradation of Lignin Model Compound

CHA-19 cells were grown in 200 ml of MSB+Glu at 28°C. After 3 days of culturing, the cells were harvested, washed, resuspended in 20 ml MSB, and transferred to an Erlenmeyer flask following the same procedures as in the polymeric lignin degradation experiment. Two representative lignin model compounds, dehydrodivanillin (DDV; BLDpharm, cat. no. BD323471; 250 mM stock solution in ethanol) and guaiacylglycerol β-guaiacyl ether (GGE; A2B Chem, cat. no. AB74526; 250 mM stock solution in dimethyl sulfoxide), were added to the flask at a final concentration of 2.5 mM. The control was prepared without the inoculation of the cell pellet. After shaking incubation at 28°C for 9 days, a small portion (1.0 ml) of the culture was centrifuged and filtered through a hydrophilic membrane. The filtrate (5.0 μl) was separated using a Phenomenex Kinetex 5 μm C18 LC column (4.6 × 250 mm) connected to an Agilent Technology 1200 HPLC System. The set parameters were as follows: flow rate, 0.5 ml/min; wavelength, 280 nm; gradient of mobile phase (acetonitrile with 0.1% formic acid/water with 0.1% formic acid), initial 30:70%, 90:10% for 15 min, 100:0% for 10 min, 100:0% for 5 min, for a total time of 30 min/run.

Cell Induction and Total RNA Extraction

CHA-19 preculture (50 ml) in MSB+Glu was transferred to 450 ml MSB+Glu and cultured at 28°C for 3 days. The grown cells were centrifuged (8,000 ×g for 20 min), washed with fresh MSB, and resuspended in 200 ml of MSB. The cell suspension was split into 50-ml aliquots, and each was induced by glucose (3 mM), vanillic acid (3 mM), or lignin (0.05%) by incubating with shaking at 28°C for 5 or 24 h in the dark. The induced cells were pelleted (8,000 ×g, 20 min, 4°C) and stored at -80°C until required. Total RNA from each sample was extracted using the easy-BLUE reagent (iNtRON Biotechnology, Republic of Korea) according to the manufacturer's instructions. The resulting RNA pellet was dissolved in RNase-free water and purified on an Amersham MicroSpin S-400 HR column (Cytiva, USA) to remove any remaining PCR inhibitor (lignin).

Target Gene mRNA Quantification Using Quantitative PCR

After DNA was removed from the total RNA extracts using DNase I (Thermo Fisher Scientific, USA), reverse transcription was performed using a qPCRBIO cDNA Synthesis Kit (PCR Biosystems, UK). The resulting cDNAs for putative LMCO, DyP, and aromatic ring-cleavage dioxygenases were amplified using the following primer pairs: (5'→3') TFH80052 (221 bp; Forward, GCCGTTACAGGAACAGGAAA; Reverse, TCTTGTTCA CACCGTTGGAG), TFH80975 (242 bp; GCCGAAGACAAGGACAACAT; CCGTCTTCCAGACCACTCAT), TFH81056 (242 bp; GCGAAGAGGTGAAAATCCTG; TTATCGCTCTGCCAGCTCTT), TFH77958 (197 bp; CCTTGAGCCTGAAGAACTGG; GCGATAGGTCAGGGTGTTGT), TFH78995 (179 bp; CAGCGAAAAGGA CAATCCAT; TGAGGTGCAGTTCGATGGTA), TFH82233 (175 bp; GACCCGAATTTCGAAGGTTT; AAT AAATCCGCGTCAGCAAG), TFH78177 (238 bp; ATTTTCGCAATCCCAAACTG; TAAGTGTCATCGTCG GTTCG), and 16S rRNA (204 bp; AAGCAACGCGAAGAACCTTA; CACCGGCAGTCTCCTTAGAG). Real-time quantitative PCR was performed on an ABI 7500 Real-Time PCR System (Thermo Fisher Scientific) using 2× qPCRBIO SyGreen Mix Lo-ROX (PCR Biosystems). Thermal cycling conditions were as follows: 95°C for 3 min, followed by 40 cycles of 95°C for 10 s, and 60°C for 30 s. The expression level of each target gene was normalized to the 16S rRNA gene as an endogenous control, and the fold-change value was calculated between vanillic acid or lignin-induced cells and glucose-induced cells using the 2-ΔΔCt method.

Results and Discussion

Growth Tests on Polymeric Lignin and Its Metabolite

In this study, no additional carbon source was available in the MSB medium; thus, strain CHA-19 could only utilize the substrate (lignin or vanillic acid) provided as the sole carbon source. To determine the growth of CHA-19 cells, CFU values were determined over a 25-day culture period. After cultivation for 3 days, CHA-19 cells reached the highest growth level (1.6 × 108 CFU/ml) on polymeric lignin and a lower level (0.7 × 108 CFU/ml) on vanillic acid (a lignin-degradative metabolite), whereas they reached to 0.3 × 108 CFU/ml in the absence of growth substrate (Fig. 1A). Compared with previous studies on bacterial growth (105–109 CFU/ml) in lignin-supplemented medium [6], CHA-19 was confirmed to be a genuine lignin degrader.

Fig. 1. (A) Viability over incubation time of Pseudomonas kribbensis CHA-19 at 28°C for 25 days. (B) Gel permeation chromatography elution profile of polymeric lignin after incubation with CHA-19 resting cells at 28°C for 15 days.

Following the confirmation of the capacity of CHA-19 to use lignin as a growth substrate, lignin decomposition was examined using chromatography. After 15 days of incubation of CHA-19 cells with lignin, a small portion of the culture was centrifuged, and the supernatant was analyzed by GPC. Intact lignin, which was not treated with CHA-19 cells (control), was separated at a retention time (RT) of 5–20 min and determined to be 9.6–642.0 kDa in size, compared with the GPC elution profile of the pullulan standard. For the CHA-19-inoculated test sample, the lignin content significantly decreased by 45% (integrated peak area of 275,204 at 7–19 min) compared with that of the control (peak area of 613,435 at 5–20 min), which is indicative of the loss of the lignin fraction owing to CHA-19 decomposition (Fig. 1B).

Lignin Model Compound Degradation

To characterize the lignin decomposition strategies, the cleavage of certain lignin linkages was examined using the lignin model compounds, DDV and GGE. After DDV bioconversion using CHA-19 resting cells for 9 days, the reaction solution was analyzed using HPLC. As shown in Fig. 2A, the DDV peak at an RT of 18.3 min almost disappeared, producing novel distinct peaks at RTs of 11.4, 15.3, and 21.8 min. This suggests that the presence of an enzyme system involved in DDV degradation and that the novel peaks are the products of the enzymatic degradation reaction. The 11.4-min peak area largely increased with incubation time, whereas the others rarely changed in their RT and peak area (data not shown). These more hydrophilic novel compounds at 11.4 and 15.3 min were assumed to be vanillic acid (9.7 min) and vanillin (12.9 min), possible metabolites through bacterial DDV bioconversion [18]; however, their RTs were not consistent with that of respective authentic compound. The DDV-derived metabolites, vanillic acid and vanillin, might have been converted to unknown dead-end products, which were not further catabolized by CHA-19. In contrast to DDV, GGE incubated with CHA-19 cells rarely changed their RT and peak area after 9 days of reaction, compared with the no-cell control (Fig. 2B), which indicated that the enzymatic system for GGE degradation was either absent or expressed at a very low level in CHA-19 cells.

Fig. 2. High-performance liquid chromatography elution profile of metabolites formed after (A) dehydrodivanillin (DDV) and (B) guaiacylglycerol β-guaiacyl ether (GGE) incubation with Pseudomonas kribbensis CHA-19 resting cells at 28°C for 9 days.

The β-aryl ether (including GGE) and biphenyl (including DDV) structures are dimeric compounds that are dominantly found in native polymeric lignin, accounting for 51% and 11%, respectively [19]. Each has been used as a model for characterization of different enzymatic reactions involving lignin decomposition. The distinct enzymes and pathways involved in the degradation of β-aryl ether (LigDD2, LigEF, and LigG) and biphenyl (LigX, LigZ, LigY, and LigWW2) structures to vanillin and/or vanillic acid are well identified and characterized in Sphingomonas paucimobilis SYK-6 [19]. The resulting vanillin and vanillic acid can be converted to each other by a reversible enzymatic reaction [18]. Considering that CHA-19 is able to grow on vanillic acid, low expressions of the catabolic enzymes for GGE degradation pathway seem to be more reasonable for CHA-19.

Identification of Lignin-Degradative Enzyme Genes Using Bioinformatic Analysis

Many lignin-degrading bacteria, including diverse genera, utilize oxidative enzymes such as DyPs and LMCOs to cleave C–C and C–O–C linkages within polymeric lignin or lignin model compounds. Genes for either DyPs [8] or LMCOs [20] frequently exist in multiple forms; however, the precise roles of different isoenzymes or genes remain largely unknown. Some bacteria were identified to possess multiple genes for both the enzymes, possibly for efficient lignin oxidation in their single host [1, 12, 14].

Gene annotation of the CHA-19 genome (approximately 6.4 Mb) revealed 5,737 coding sequences, of which several putative HA-degradative genes were detected and used to propose an HA-degradation pathway [17]: LMCOs (GenBank Accession Nos. TFH77958 and TFH78995), DyPs (GenBank Accession Nos. TFH80052, TFH80975, and TFH81056), protocatechuate 3,4-dioxygenase (P34O; GenBank accession no. TFH82233), and catechol 1,2-dioxygenase (C12O; GenBank Accession No. TFH78177). Based on the structural similarity between HA and lignin and the presence of main lignin components (especially guaiacol) in the HA structure, the LMCO-and DyP-annotated genes were assumed to be involved in the initial lignin oxidative degradation, with P34O- and C12O-annotated genes performing aromatic ring cleavage of lignin-derived small metabolites. The operonic structures of these genes and other neighboring genes and their predicted functions are depicted and summarized in Fig. 3A and Table 1. Several studies reported on bacterial laccase, LMCOs, and DyPs that initiate the lignin decomposition via β-O-4 ether bond cleavage in lignin [10, 21, 22]. Bacterial DyPs were characterized to cleave Cα–Cβ bond in β-aryl ether structures (e.g., GGE) within lignin polymer, finally producing small-molecular-weight, lignin-derived compounds, such as guaiacol and vanillin as main metabolites [8, 23]. Some bacterial lignin catabolic pathways lead to the production of vanillin or its oxidation product vanillic acid, which is converted to protocatechuic acid and can be degraded via oxidative ortho-ring cleavage using P34O. In an alternative pathway, vanillic acid is decarboxylated to guaiacol, which is converted to catechol, the aromatic ring of which can be cleaved via meta-ring reacting with C12O.

Table 1 . Gene annotation of putative LMCOs & DyPs and neighboring proteins on strain CHA-19 genome.

Gene IDLength (aa)Best hit [bacterial or fungal source]aIdentity (%)
TFH77956318tRNA (mo5U34)-methyltransferase [Pseudomonas syringae pv. tomato]253/317 (80%)
TFH77957165tRNA-specific adenosine deaminase [Escherichia coli]73/143 (51%)
TFH77958458Copper oxidase [Pseudomonas parafulva]356/420 (85%)
TFH779591449Cytotoxic necrotizing factor [Yersinia pseudotuberculosis]85/405 (21%)
TFH77960525GMP synthase [Escherichia coli]383/525 (73%)
TFH78993221Ribonuclease I [Escherichia coli]47/206 (23%)
TFH78994160No significant similarity
TFH78995559Laccase [Botrytis aclada]102/290 (35%)
TFH78996285Copper resistance protein B [Escherichia coli]130/215 (60%)
TFH78997124Copper resistance protein C [Pseudomonas syringae]82/102 (80%)
TFH78998287No significant similarity
TFH79018282Cyclohexadienyl dehydratase [Pseudomonas aeruginosa]120/232 (52%)
TFH80048554AMP-dependent synthetase and ligase [Brucella canis]313/544 (58%)
TFH80049338AraC family transcriptional regulator [Pseudomonas aeruginosa]34/83 (41%)
TFH80050282No significant similarity
TFH80051399Iron uptake system protein EfeO [Escherichia coli]132/324 (41%)
TFH80052432Peroxidase EfeB [Sphingomonas sp.]280/380 (74%)
TFH80053274Efem M75 Peptidase [Pseudomonas syringae pv. syringae]221/255 (87%)
TFH80054447Phosphatidylserine synthase [Haemophilus influenzae]215/443 (49%)
TFH80055188Putative TetR-family transcriptional regulator [Streptomyces avermitilis]52/169 (31%)
TFH80973315No significant similarity
TFH80974344AraC family transcriptional regulator [Pseudomonas aeruginosa]33/84 (39%)
TFH80975296Dyp-type peroxidase family protein [Pseudomonas putida]185/289 (64%)
TFH809763221,5-Anhydro-D-fructose reductase [Sinorhizobium meliloti]93/267 (35%)
TFH80977250HTH-type transcriptional repressor YvoA [Bacillus subtilis]73/241 (30%)
TFH80978576α-Subunit of PAPS reductase [Methanothermococcus thermolithotrophicus]160/539 (30%)
TFH8097981β-Subunit of PAPS reductase [Methanothermococcus thermolithotrophicus]20/59 (34%)
TFH80896262ROB transcription factor [Escherichia coli]30/99 (30%)
TFH80895570Type six secretion system exported effector 8 [Pseudomonas aeruginosa]500/568 (88%)
TFH81056311Putative iron-dependent peroxidase [Streptomyces lividans]189/313 (60%)
TFH80894325No significant similarity
TFH80893366Polyamine transport protein [Pseudomonas aeruginosa]194/345 (56%)
TFH80892468No significant similarity
TFH80891161Flavin reductase-like, FMN-binding protein [Mycolicibacterium thermoresistibile]58/153 (38%)
TFH80890347Luciferase-like monooxygenase [Streptomyces bottropensis]98/347 (28%)

aThe query sequences were searched against Protein Data Bank (PDB) database using NCBI Blastx program.
Fig. 3. (A) Operonic structure of putative genes for initial lignin oxidative enzymes and neighboring proteins on Pseudomonas kribbensis CHA-19 genome. The gene IDs for dye-decolorizing peroxidase (DyP; TFH80052, TFH80975, and TFH81056) and laccase-like multicopper oxidases (LMCO; TFH77958 and TFH78995) are shown in red letters. (B) Comparison of mRNA expression levels of target genes in CHA-19 cells induced by vanillic acid (Van) or lignin (Lig) with those by glucose (Glu). mRNAs were extracted from the CHA-19 cells after 5- or 24-h induction at 28°C.

Targeted mRNA Analysis for Lignin Decomposition

To quantitatively analyze the expression levels of specific genes predicted to be involved in lignin decomposition and lignin metabolite degradation, the putative LMCO, DyP, P34O, and C12O genes were induced in CHA-19 cells by incubation with lignin or vanillic acid. Subsequently, real-time quantitative PCR was performed using the mRNA from individually induced cells. As shown in Fig. 3B and Table 2, when CHA-19 cells were induced with lignin for 5 h, the mRNA expression levels of two LMCO genes were significant (expression fold change, 3.4–3.7) compared with glucose-induced cells, and the fold change increased considerably to 5.6–7.9 after 24-h induction. The expression patterns of the P34O and C12O genes were similar to those of the LMCO genes (i.e., higher expression with an increase in induction time). Three DyP genes were more significantly expressed (fold change, 2.0–6.4) after 24 h than after 5 h. In summary, all genes tested were distinctly expressed, indicating their involvement in polymeric lignin decomposition. Remarkably, the mRNA expression levels of the LMCO and P34O genes in vanillic acid-induced cells remained high (expression fold change, >1.8) from 5 to 24 h, which is indicative of their main functions in lignin decomposition.

Table 2 . Fold changes in mRNA expressions of strain CHA-19 genes involved in the decomposition of lignin and its related compounds.

InductionTFH80052 (DyP)TFH80975 (DyP)TFH81056 (DyP)TFH77958 (LMCO)TFH78995 (LMCO)TFH82233 (P34O)TFH78177 (C12O)
TimeSubstrate
5-hGlu1.0 (± 0.1)a1.0 (± 0.1)1.0 (± 0.3)1.0 (± 0.1)1.0 (± 0.1)1.0 (± 0.1)1.0 (± 0.1)
Van1.5 (± 0.1)0.6 (± 0.1)0.9 (± 0.2)2.5 (± 0.1)2.2 (± 0.3)2.5 (± 0.1)1.3 (± 0.1)
Lig1.9 (± 0.1)1.0 (± 0.1)1.4 (± 0.7)3.4 (± 0.4)3.7 (± 0.8)3.1 (± 0.6)1.8 (± 0.1)
24-hGlu1.0 (± 0.2)1.0 (± 0.0)1.0 (± 0.0)1.0 (± 0.2)1.0 (± 0.0)1.0 (± 0.1)1.0 (± 0.1)
Van2.2 (± 1.0)1.8 (± 0.1)0.9 (± 0.1)1.8 (± 0.1)2.6 (± 0.3)2.1 (± 0.3)1.7 (± 0.1)
Lig6.4 (± 1.8)5.4 (± 0.1)2.0 (± 0.5)5.6 (± 0.7)7.9 (± 0.9)6.5 (± 0.4)3.7 (± 0.3)

aThe fold change values from qPCR results are mean (± standard deviation) of three technical replicate. Higher than 2.0-fold changes are highlighted in bold. Abbreviations: Glu, glucose; Van, vanillic acid; Lig, lignin.

Functional Prediction of DyPs and LMCOs for Initial Lignin Decomposition

To gain a deeper insight into the function of LMCOs and DyPs from CHA-19, we used local alignments using well-known databases and computer-aided enzyme modeling. DyP enzymes belong to a family of heme peroxidases, which are mainly derived from fungal sources and have wide substrate specificity. DyPs have been found in a variety of organisms, functioning in a wide cellular distribution range, from intracellular to extracellular, including the periplasmic space. In the RedoxiBase database [24], DyPs are categorized as classes A, B, C, and D by primary sequence homology. Recently, these DyP groups were reclassified as classes I, P, and V, respectively, using the multiple three-dimensional alignment tool [25]. In the new classification, the three DyPs (TFH80052, TFH80975, and TFH81056) from CHA-19 were classified into subclasses I3, P3, and P4, respectively (Fig. 4). Class I DyPs found in bacteria have twin arginine translocation (Tat) signal sequences that are exported into the periplasmic space. TFH80052 also has a predicted N-terminal Tat sequence, which has a high sequence identity with EfeB from Escherichia coli. The Efe system is a mechanism for siderophore-independent iron uptake induced by low pH or iron concentrations [26]. On the CHA-19 genome, we also found an EfeO homologue (TFH80051) related to the Efe system (Table 1). EfeB has bifunctional catalytic properties, with guaiacol peroxidase activity at low pH [27]. Lignin decomposition by class I DyPs has been reported for bacterial enzymes, such as DyPA from Pseudomonas fluorescens pf-5 [9], TfuDyP from Thermobifida fusca [28], and SviDyP from Saccharomonospora viridis DSM43017 [29]. Although TFH80052 and TFH81056 have putative signal peptides, we could not identify a signal peptide in TFH80975 using SignalP analysis [30]. TFH80975 is highly similar to PpDyP (DyP from Pseudomonas putida), which has high catalytic activity against lignin-related phenolic compounds. Recombinant PpDyP was expressed as a homotetramer. TFH81056 contains the Sec signal sequence and has 59% identity with DyPB from Rhodococcus jostii RHA1, which catalyzes the oxidative degradation of kraft lignin [8]. RHA1 contains two DyPs (DyPA and DyPB). DyPA is highly similar to TFH80052, which has been identified as class I. DyPB is expressed as a cargo enzyme in encapsulin, a self-assembling protein nanocompartment [31]. However, we found no encapsulation-related genes in the vicinity of TFH81056 in the CHA-19 genome.

Fig. 4. Phylogenetic tree and structure models of three DyPs expressed in Pseudomonas kribbensis CHA-19. (A) Phylogenetic analysis of the CHA-19 DyPs (TFH80052, TFH80975, and TFH81056). Multiple sequence alignment of the proteins was performed using ClustalW. The sequences represented by NCBI reference number were used for phylogenetic analysis. The phylogenetic tree construction from the aligned sequences was performed using MEGA 11. The phylogenetic tree was visualized using iTOL version 6. EfeB from Escherichia coli, PpDyP from Pseudomonas putida, and DyPB from Rhodococcus jostii RHA1 are shown as representative enzymes of the subclasses I3, P3, and P4, respectively. (B) Overall structure of the CHA-19 DyPs predicted by ColabFold platform. Left, predicted multimer structure of each protein; middle, superimposition of the predicted DyPs structures with their corresponding proteins, EfeB (PDB ID: 3O72), PpDyP (PDB ID: 7QYQ), and DyPB (PDB ID: 3QNS); right, zoom-in view of the heme active site. The heme site structures are shown as stick and sphere models. The water molecule is depicted as a cyan sphere. The active site residues have hydrogen bond interaction with heme molecule in PDB data of DyPs.

MCO is a superfamily of oxidoreductases that catalyze the catalytic oxidation of various substrates, including phenolic compounds and polyphenols such as lignin. LMCO is a specific member of the MCO family that plays an important role in the lignin degradation pathway. Bioinformatics analysis of lignin-degrading bacteria, including RHA1, revealed that their genomes contain putative MCO and DyP genes [32]. CHA-19 cells distinctly expressed two LMCO genes, TFH77958 and TFH78995, upon induction by lignin or lignin-derived vanillic acid (Table 2). This suggests that both genes are involved in the lignin decomposition flux. Based on the classification of MCOs [32], phylogenetic analysis categorized TFH77958 and TFH78995 into groups A and C, respectively (Fig. 5A and 5B). TFH77958 was identified as a group A blue laccase enzyme known to oxidize lignin and its derivatives. Some group C enzymes, likely colorless pseudo-laccases, are known to be involved in copper homeostasis. Compared with studies on the function and diversity of fungal LMCOs, little is known about bacterial LMCOs and their possible implication in lignin decomposition [20].

Fig. 5. Phylogenetic analysis and structure prediction of two LMCOs expressed in Pseudomonas kribbensis CHA-19: (A) TFH77958 and (B) TFH78995. The phylogenetic tree was obtained by applying a neighbor-joining algorithm to the ClustalW multiple sequence alignment of MCOs. The protein structures of LMCOs were predicted by the ColabFold platform.

In conclusion, the synergistic decomposition of polymeric lignin by a fungal and bacterial consortium appears to occur in natural environments, including cold bipolar tundra soils. Smaller lignin fractions produced through microbial decomposition should be examined in terms of lignin valorization to produce value-added chemicals. Until now, evidence that bacterial enzymes play a more significant role in lignin decomposition than their fungal counterparts has been insufficient and ambiguous. Overall, combined with the fact that CHA-19 can grow on polymeric lignin and lignin-derived small metabolites (phenol, benzoic acid, ferulic acid, and vanillic acid), the spectroscopic data presented here rigorously corroborate the ability of CHA-19 to decompose lignin and lignin model compounds (DDV). CHA-19 seems to prefer LMCOs for initial oxidative lignin decomposition to DyPs, producing smaller metabolites, such as vanillic acid, which is further degraded via a P34O-assisted aromatic ring cleavage pathway (Table 2 and Fig. 6). Studies at the bacterial single-cell level are essential for determining the complexities of lignin decomposition; nevertheless, these approaches have limitations regarding the entire function of bacterial communities in natural environments. However, this study helps to better understand the role of bacteria in lignin decomposition, and thus in terrestrial ecosystems, thereby expanding the biocatalytic toolbox with new bacterial cells and their degradative enzymes for lignin valorization.

Fig. 6. Proposed lignin decomposition pathway (vanillic acid route) in Pseudomonas kribbensis CHA-19. Dotted and solid lines represent multistep reactions by different enzymes and one-step reaction by one enzyme, respectively.

Abbreviations

CFU, colony-forming units per milliliter

DDV, dehydrodivanillin

DyPs, dye-decolorizing peroxidases

GGE, guaiacylglycerol β-guaiacyl ether

GPC, gel permeation chromatography

HA, humic acids

HPLC, high-performance liquid chromatography LMCOs, laccase-like multicopper oxidases MCOs, multicopper oxidases

MSB, mineral salts base

RT, retention time

Tat, twin arginine translocation

Acknowledgments

This work was supported by a Korea Polar Research Institute (KOPRI) grant funded by the Ministry of Oceans and Fisheries (KOPRI PE24130).

Author Contributions

Dockyu Kim: Conceptualization, Investigation, Formal analysis, Writing–original draft, Writing–review & editing

Han-Woo Kim: Conceptualization, Formal analysis, Writing–original draft, Writing–review & editing Hyoungseok Lee: Funding acquisition, Writing - review & editing

Conflict of Interest

The authors have no financial conflicts of interest to declare.

References

  1. Granja-Travez RS, Bugg TDH. 2018. Characterization of multicopper oxidase CopA from Pseudomonas putida KT2440 and Pseudomonas fluorescens Pf-5: involvement in bacterial lignin oxidation. Arch. Biochem. Biophys. 660: 97-107.
    Pubmed CrossRef
  2. Bruijnincx PCA, Rinaldi R, Weckhuysen BM. 2015. Unlocking the potential of a sleeping giant: lignins as sustainable raw materials for renewable fuels, chemicals and materials. Green Chem. 17: 4860-4861.
    CrossRef
  3. Kamimura N, Sakamoto S, Mitsuda N, Masai E, Kajita S. 2019. Advances in microbial lignin degradation and its applications. Curr. Opin. Biotechnol. 56: 179-186.
    Pubmed CrossRef
  4. Hermosilla E, Schalchli H, Mutis A, Diez MC. 2017. Combined effect of enzyme inducers and nitrate on selective lignin degradation in wheat straw by Ganoderma lobatum. Environ. Sci. Pollut. Res. 24: 21984-21996.
    Pubmed CrossRef
  5. Sainsbury PD, Hardiman EM, Ahmad M, Otani H, Seghezzi N, Eltis LD, et al. 2013. Breaking down lignin to high-value chemicals: the conversion of lignocellulose to vanillin in a gene deletion mutant of Rhodococcus jostii RHA1. ACS Chem. Biol. 8: 2151-2156.
    Pubmed CrossRef
  6. Xu Z, Qin L, Cai M, Hua W, Jin M. 2018. Biodegradation of kraft lignin by newly isolated Klebsiella pneumoniae, Pseudomonas putida, and Ochrobactrum tritici strains. Environ. Sci. Pollut. Res. 25: 14171-14181.
    Pubmed CrossRef
  7. Tian JH, Pourcher AM, Klingelschmitt F, Le Roux S, Peu P. 2016. Class P dye-decolorizing peroxidase gene: degenerated primers design and phylogenetic analysis. J. Microbiol. Methods 130: 148-153.
    Pubmed CrossRef
  8. Ahmad M, Roberts JN, Hardiman EM, Singh R, Eltis LD, Bugg TD. 2011. Identification of DypB from Rhodococcus jostii RHA1 as a lignin peroxidase. Biochemistry 50: 5096-5107.
    Pubmed CrossRef
  9. Rahmanpour R, Bugg TD. 2015. Characterisation of dyp-type peroxidases from Pseudomonas fluorescens Pf-5: oxidation of Mn(II) and polymeric lignin by Dyp1B. Arch. Biochem. Biophys. 574: 93-98.
    Pubmed CrossRef
  10. Yang J, Gao T, Zhang Y, Wang S, Li H, Li S, et al. 2019. Degradation of the phenolic β-ether lignin model dimer and dyes by dyedecolorizing peroxidase from Bacillus amyloliquefaciens. Biotechnol. Lett. 41: 1015-1021.
    Pubmed CrossRef
  11. Majumdar S, Lukk T, Solbiati JO, Bauer S, Nair SK, Cronan JE, et al. 2014. Roles of small laccases from Streptomyces in lignin degradation. Biochemistry 53: 4047-4058.
    Pubmed CrossRef
  12. Kim D, Park HJ, Sul WJ, Park H. 2018. Transcriptome analysis of Pseudomonas sp. from subarctic tundra soil: pathway description and gene discovery for humic acids degradation. Folia Microbiol (Praha). 63: 315-323.
    Pubmed CrossRef
  13. Park HJ, Lee YM, Do H, Lee JH, Kim E, Lee H, et al. 2021. Involvement of laccase-like enzymes in humic substance degradation by diverse polar soil bacteria. Folia Microbiol (Praha) 66: 331-340.
    Pubmed CrossRef
  14. Rashid GMM, Sodre V, Luo J, Bugg TDH. 2024. Overexpression of endogenous multi-copper oxidases mcoA and mcoC in Rhodococcus jostii RHA1 enhances lignin bioconversion to 2,4-pyridine-dicarboxylic acid. Biotechnol. Bioeng. 121: 1366-1370.
    Pubmed CrossRef
  15. Picart P, Muller C, Mottweiler J, Wiermans L, Bolm C, Dominguez de Maria P, et al. 2014. From gene towards selective biomass valorization: bacterial β-etherases with catalytic activity on lignin-like polymers. ChemSusChem 7: 3164-3171.
    Pubmed CrossRef
  16. Husarcikova J, Voss H, Dominguez de Maria P, Schallmey A. 2018. Microbial β-etherases and glutathione lyases for lignin valorisation in biorefineries: current state and future perspectives. Appl. Microbiol. Biotechnol. 102: 5391-5401.
    Pubmed CrossRef
  17. Kim D, Lee H. 2019. Draft genome sequence of humic substances-degrading Pseudomonas kribbensis CHA-19 from temperate forest soil. Korean J. Microbiol. 55: 177-179.
  18. Chen W, Ohmori M, Ohmiya K, Shimizu S. 1988. Enzymatic conversion of dehydrodivanillin to vanillin by an anaerobic recombinant FE7. J. Ferment. Technol. 66: 341-346.
    CrossRef
  19. Masai E, Katayama Y, Fukuda M. 2007. Genetic and biochemical investigations on bacterial catabolic pathways for lignin-derived aromatic compounds. Biosci. Biotechnol. Biochem. 71: 1-15.
    Pubmed CrossRef
  20. Kellner H, Luis P, Zimdars B, Kiesel B, Buscot F. 2008. Diversity of bacterial laccase-like multicopper oxidase genes in forest and grassland cambisol soil samples. Soil Biol. Biochem. 40: 638-648.
    CrossRef
  21. Freedman Z, Zak DR. 2014. Atmospheric N deposition increases bacterial laccase-like multicopper oxidases: implications for organic matter decay. Appl. Environ. Microbiol. 80: 4460-4468.
    Pubmed PMC CrossRef
  22. Zhu D, Liang N, Zhang R, Ahmad F, Zhang W, Yang B, et al. 2020. Insight into depolymerization mechanism of bacterial laccase for lignin. ACS Sustain. Chem. Eng. 8: 12920-12933.
    CrossRef
  23. Lin L, Cheng Y, Pu Y, Sun S, Li X, Jin M, et al. 2016. Systems biology-guided biodesign of consolidated lignin conversion. Green Chem. 18: 5536-5547.
    CrossRef
  24. Savelli B, Li Q, Webber M, Jemmat AM, Robitaille A, Zamocky M, et al. 2019. Redoxibase: a database for ROS homeostasis regulated proteins. Redox Biol. 26: 101247.
    Pubmed PMC CrossRef
  25. Yoshida T, Sugano Y. 2015. A structural and functional perspective of dyp-type peroxidase family. Arch. Biochem. Biophys. 574: 49-55.
    Pubmed CrossRef
  26. Nakatsuji S, Okumura K, Takase R, Watanabe D, Mikami B, Hashimoto W. 2022. Crystal structures of EfeB and EfeO in a bacterial siderophore-independent iron transport system. Biochem. Biophys. Res. Commun. 594: 124-130.
    Pubmed CrossRef
  27. Liu X, Du Q, Wang Z, Zhu D, Huang Y, Li N, et al. 2011. Crystal structure and biochemical features of EfeB/YcdB from Escherichia coli O157: Asp235 plays divergent roles in different enzyme-catalyzed processes. J. Biol. Chem. 286: 14922-14931.
    Pubmed PMC CrossRef
  28. van Bloois E, Torres Pazmino DE, Winter RT, Fraaije M.W. 2010. A robust and extracellular heme-containing peroxidase from Thermobifida fusca as prototype of a bacterial peroxidase superfamily. Appl. Microbiol. Biotechnol. 86: 1419-1430.
    Pubmed PMC CrossRef
  29. Yu W, Liu W, Huang H, Zheng F, Wang X, Wu Y, et al. 2014. Application of a novel alkali-tolerant thermostable DyP-type peroxidase from Saccharomonospora viridis DSM 43017 in biobleaching of eucalyptus kraft pulp. PLoS One 9: e110319.
    Pubmed PMC CrossRef
  30. Teufel F, Almagro Armenteros JJ, Johansen AR, Gislason MH, Pihl SI, Tsirigos KD, et al. 2022. Signalp 6.0 predicts all five types of signal peptides using protein language models. Nat. Biotechnol. 40: 1023-1025.
    Pubmed PMC CrossRef
  31. Rahmanpour R, Bugg TD. 2013. Assembly in vitro of Rhodococcus jostii RHA1 encapsulin and peroxidase DypB to form a nanocompartment. FEBS J. 280: 2097-2104.
    Pubmed CrossRef
  32. Granja-Travez RS, Persinoti GF, Squina FM, Bugg TDH. 2020. Functional genomic analysis of bacterial lignin degraders: diversity in mechanisms of lignin oxidation and metabolism. Appl. Microbiol. Biotechnol. 104: 3305-3320.
    Pubmed CrossRef

Related articles in JMB

More Related Articles

Article

Research article

J. Microbiol. Biotechnol. 2024; 34(9): 1867-1875

Published online September 28, 2024 https://doi.org/10.4014/jmb.2406.06021

Copyright © The Korean Society for Microbiology and Biotechnology.

Kraft Lignin Decomposition by Forest Soil Bacterium Pseudomonas kribbensis CHA-19

Dockyu Kim1,2*, Han-Woo Kim1,2*, and Hyoungseok Lee1,2

1Division of Life Sciences, Korea Polar Research Institute, Incheon 21990, Republic of Korea
2Department of Polar Sciences, University of Science and Technology, Incheon 21990, Republic of Korea

Correspondence to:D Kim,          envimic@kopri.re.kr
HW Kim,       hwkim@kopri.re.kr

Received: June 11, 2024; Revised: June 27, 2024; Accepted: July 5, 2024

Abstract

Identification of the biochemical metabolic pathway for lignin decomposition and the responsible degradative enzymes is needed for the effective biotechnological valorization of lignin to renewable chemical products. In this study, we investigated the decomposition of kraft lignin by the soil bacterium Pseudomonas kribbensis CHA-19, a strain that can utilize kraft lignin and its main degradation metabolite, vanillic acid, as growth substrates. Gel permeation chromatography revealed that CHA-19 decomposed polymeric lignin and degraded dehydrodivanillin (a representative lignin model compound); however, the degradative enzyme(s) and mechanism were not identified. Quantitative polymerase chain reaction with mRNAs from CHA-19 cells induced in the presence of lignin showed that the putative genes coding for two laccase-like multicopper oxidases (LMCOs) and three dye-decolorizing peroxidases (DyPs) were upregulated by 2.0- to 7.9-fold compared with glucose-induced cells, which indicates possible cooperation with multiple enzymes for lignin decomposition. Computational homology analysis of the protein sequences of LMCOs and DyPs also predicted their roles in lignin decomposition. Based on the above data, CHA-19 appears to initiate oxidative lignin decomposition using multifunctional LMCOs and DyPs, producing smaller metabolites such as vanillic acid, which is further degraded via ortho- and meta-ring cleavage pathways. This study not only helps to better understand the role of bacteria in lignin decomposition and thus in terrestrial ecosystems, but also expands the biocatalytic toolbox with new bacterial cells and their degradative enzymes for lignin valorization.

Keywords: Bacterial peroxidase, bacterial laccase, biocatalyst, biodegradation, kraft lignin, Pseudomonas

Introduction

Lignocellulose is composed of cellulose, hemicellulose, and lignin, and is the largest organic polymer reservoir in the ecosystem. As a major component (15%–30%) of lignocellulosic biomass, lignin is a complex and heterogeneous aromatic polymer found in the cell walls of plants and has the potential to be a valuable resource for producing renewable chemicals [1]. Ongoing research into the extraction and modification of lignin for various applications contributes to the development of more sustainable and environmentally friendly technologies. Lignin is a byproduct (approximately 50 million tons annually) of the pulp and paper industry, which in combination with commercial cellulosic ethanol production helps provide an oversupply of lignin [2]. Therefore, lignin has gained attention owing to its potential industrial applications in producing biofuels, adhesives, and other value-added chemicals.

Lignin valorization refers to the extraction of compounds such as vanillin, flavor, and other value-added chemicals [3] from lignin, and is thus considered a key process in the successful development of lignocellulosic biorefineries. Several strategies have emerged for lignin valorization, including chemical, biological, and thermochemical processes, which are necessary for taking full advantage of lignin’s potential as a natural resource. However, owing to its polymeric structural complexity and high molecular weight, lignin is insoluble in water and resistant to microbial and enzymatic degradation, making lignin breakdown a challenging task. Biological conversion processes using microbial cells (bacteria or fungi) or their extracellular enzymes can break down lignin into simpler molecules and valuable products such as biofuels or bioplastics [4].

Soil fungal basidiomycetes, especially white-rot fungi, have been well characterized to oxidatively decompose lignin using extracellular lignin peroxidases, laccases, and manganese peroxidases, which can break down the complex structure of lignin. The resulting small aromatic and aliphatic compounds are completely degraded by the surrounding bacteria. For example, vanillic acid, the main aromatic metabolite resulting from enzymatic lignin cleavage [5], is converted to protocatechuate, which is further degraded via ortho and/or meta cleavage pathways. Many lignin-degrading bacteria in several genera (Rhodococcus, Amycolatopsis, Pseudomonas, Ochrobactrum, Bacillus, and Streptomyces) were isolated from various natural and industrial environments [6]. From them, peroxidases [7], dye-decolorizing peroxidases (DyPs) [8-10], laccases [11], laccase-like enzymes [1, 12, 13], multicopper oxidases (MCOs) [14], and β-etherases [15, 16] have been detected and assumed to cleave C–C and C–O–C linkages within lignin. Although fungal ligninolytic capability is much higher than that of bacteria, some bacterial strains can be explored for lignin valorization because of their rapid growth, easy genetic manipulation, and metabolic versatility with diverse catalytic enzyme systems and pathways. Particularly, bacterial laccases are more thermostable and resistant to harsh conditions (alkali pH and salinity), and their overproduction of recombinant enzymes is accomplished relatively easier than with their fungal counterparts [1]. Therefore, the bacterial strains with higher ligninolytic capability and efficient bioconversion systems are prerequisite for successful lignin valorization [6].

Here, we aimed to characterize a potential lignin-degrading bacterium isolated from forest organic soil that exhibited rapid growth in a medium containing kraft lignin as the sole carbon source. The lignin-degrading capability of the isolate was determined physiologically and spectrophotometrically, and its putative ligninolytic enzymes (DyPs and LMCOs) responsible for the initial lignin decomposition were analyzed using mRNA-targeted quantitative polymerase chain reaction (PCR) and computer-aided functional prediction methods. This bacterial isolate is valuable for lignin valorization because of its growth capability, decomposition activity, and cooperative reaction between multiple ligninolytic enzymes.

Materials and Methods

Growth Test on Polymeric Lignin and Lignin Metabolite

Pseudomonas kribbensis CHA-19 (KCTC 72262) was previously isolated from forest organic soil in New Jersey, USA, owing to its ability to degrade polymeric humic acids (HA). The draft genome sequence of strain CHA-19 was analyzed to identify the genes involved in HA decomposition, and its HA-degradative pathway was proposed previously [17]. CHA-19 was inoculated into mineral salts basal (MSB) broth containing 20 mM glucose (MSB+Glu) and incubated at 28°C for 2 days with shaking. After culturing, the glucose adhering to the cell surface and remaining in the culture medium was removed by centrifuging (8,000 ×g for 20 min) and washing the cell pellet with new MSB broth. The cell suspension in MSB was transferred to 50 ml of fresh MSB in an Erlenmeyer flask (250 ml) at an absorbance at 600 nm of 0.1. Kraft lignin (Sigma-Aldrich, cat. no. 370959, USA) and vanillic acid (Sigma-Aldrich, cat. no. H36001) were completely dissolved in 1.0 N NaOH (10% stock solution) and distilled water with a small amount of NaOH (250 mM stock solution), respectively, and added to a flask at final concentrations of 0.05% (lignin) and 3 mM (vanillic acid). During culturing at 28°C for 25 days, at indicated time intervals, 100 μl of the culture was diluted in MSB, and 100 μl of this dilution was plated on MSB+Glu. After incubation at 28°C, the number of colony-forming units (CFU) per milliliter was calculated.

Decomposition of Polymeric Lignin

Strain CHA-19 was grown in 80 ml MSB+Glu at 28°C for 3 days with shaking, and the cells were harvested by centrifugation (8,000 ×g for 20 min). The pellet was resuspended in 40 ml MSB and transferred to an Erlenmeyer flask (250 ml). Kraft lignin was then added to the flask at a final concentration of 0.05%. The control was prepared without the inoculation of the cell pellet. The flasks were incubated with shaking at 28°C, and the structural changes in lignin owing to the decomposition activity of CHA-19 were analyzed by gel permeation chromatography (GPC), as described below.

After 15 days of incubation, a small portion (1.0 ml) of the culture was centrifuged (10,000 ×g for 10 min). The supernatant was filtered through a hydrophilic membrane (0.2 μm), and the filtrate (20.0 μl, 0.5 mg of lignin/ml) was separated using Shodex OHpak SB-G 6B guard (6.0 mm ID × 50 mm length), SB-804 HQ (8.0 × 300 mm), and SB-805 HQ (8.0 × 300 mm) columns tandemly connected to an Agilent Technology 1200 HPLC (high-performance liquid chromatography) System. The flow rate of the mobile phase (degassed water) was 0.5 ml/min, and the GPC eluates were examined with a refractive index detector. A set of Shodex standard pullulan samples (kit P-82; 9,600–642,000 Da) was used as the molecular weight reference.

Degradation of Lignin Model Compound

CHA-19 cells were grown in 200 ml of MSB+Glu at 28°C. After 3 days of culturing, the cells were harvested, washed, resuspended in 20 ml MSB, and transferred to an Erlenmeyer flask following the same procedures as in the polymeric lignin degradation experiment. Two representative lignin model compounds, dehydrodivanillin (DDV; BLDpharm, cat. no. BD323471; 250 mM stock solution in ethanol) and guaiacylglycerol β-guaiacyl ether (GGE; A2B Chem, cat. no. AB74526; 250 mM stock solution in dimethyl sulfoxide), were added to the flask at a final concentration of 2.5 mM. The control was prepared without the inoculation of the cell pellet. After shaking incubation at 28°C for 9 days, a small portion (1.0 ml) of the culture was centrifuged and filtered through a hydrophilic membrane. The filtrate (5.0 μl) was separated using a Phenomenex Kinetex 5 μm C18 LC column (4.6 × 250 mm) connected to an Agilent Technology 1200 HPLC System. The set parameters were as follows: flow rate, 0.5 ml/min; wavelength, 280 nm; gradient of mobile phase (acetonitrile with 0.1% formic acid/water with 0.1% formic acid), initial 30:70%, 90:10% for 15 min, 100:0% for 10 min, 100:0% for 5 min, for a total time of 30 min/run.

Cell Induction and Total RNA Extraction

CHA-19 preculture (50 ml) in MSB+Glu was transferred to 450 ml MSB+Glu and cultured at 28°C for 3 days. The grown cells were centrifuged (8,000 ×g for 20 min), washed with fresh MSB, and resuspended in 200 ml of MSB. The cell suspension was split into 50-ml aliquots, and each was induced by glucose (3 mM), vanillic acid (3 mM), or lignin (0.05%) by incubating with shaking at 28°C for 5 or 24 h in the dark. The induced cells were pelleted (8,000 ×g, 20 min, 4°C) and stored at -80°C until required. Total RNA from each sample was extracted using the easy-BLUE reagent (iNtRON Biotechnology, Republic of Korea) according to the manufacturer's instructions. The resulting RNA pellet was dissolved in RNase-free water and purified on an Amersham MicroSpin S-400 HR column (Cytiva, USA) to remove any remaining PCR inhibitor (lignin).

Target Gene mRNA Quantification Using Quantitative PCR

After DNA was removed from the total RNA extracts using DNase I (Thermo Fisher Scientific, USA), reverse transcription was performed using a qPCRBIO cDNA Synthesis Kit (PCR Biosystems, UK). The resulting cDNAs for putative LMCO, DyP, and aromatic ring-cleavage dioxygenases were amplified using the following primer pairs: (5'→3') TFH80052 (221 bp; Forward, GCCGTTACAGGAACAGGAAA; Reverse, TCTTGTTCA CACCGTTGGAG), TFH80975 (242 bp; GCCGAAGACAAGGACAACAT; CCGTCTTCCAGACCACTCAT), TFH81056 (242 bp; GCGAAGAGGTGAAAATCCTG; TTATCGCTCTGCCAGCTCTT), TFH77958 (197 bp; CCTTGAGCCTGAAGAACTGG; GCGATAGGTCAGGGTGTTGT), TFH78995 (179 bp; CAGCGAAAAGGA CAATCCAT; TGAGGTGCAGTTCGATGGTA), TFH82233 (175 bp; GACCCGAATTTCGAAGGTTT; AAT AAATCCGCGTCAGCAAG), TFH78177 (238 bp; ATTTTCGCAATCCCAAACTG; TAAGTGTCATCGTCG GTTCG), and 16S rRNA (204 bp; AAGCAACGCGAAGAACCTTA; CACCGGCAGTCTCCTTAGAG). Real-time quantitative PCR was performed on an ABI 7500 Real-Time PCR System (Thermo Fisher Scientific) using 2× qPCRBIO SyGreen Mix Lo-ROX (PCR Biosystems). Thermal cycling conditions were as follows: 95°C for 3 min, followed by 40 cycles of 95°C for 10 s, and 60°C for 30 s. The expression level of each target gene was normalized to the 16S rRNA gene as an endogenous control, and the fold-change value was calculated between vanillic acid or lignin-induced cells and glucose-induced cells using the 2-ΔΔCt method.

Results and Discussion

Growth Tests on Polymeric Lignin and Its Metabolite

In this study, no additional carbon source was available in the MSB medium; thus, strain CHA-19 could only utilize the substrate (lignin or vanillic acid) provided as the sole carbon source. To determine the growth of CHA-19 cells, CFU values were determined over a 25-day culture period. After cultivation for 3 days, CHA-19 cells reached the highest growth level (1.6 × 108 CFU/ml) on polymeric lignin and a lower level (0.7 × 108 CFU/ml) on vanillic acid (a lignin-degradative metabolite), whereas they reached to 0.3 × 108 CFU/ml in the absence of growth substrate (Fig. 1A). Compared with previous studies on bacterial growth (105–109 CFU/ml) in lignin-supplemented medium [6], CHA-19 was confirmed to be a genuine lignin degrader.

Figure 1. (A) Viability over incubation time of Pseudomonas kribbensis CHA-19 at 28°C for 25 days. (B) Gel permeation chromatography elution profile of polymeric lignin after incubation with CHA-19 resting cells at 28°C for 15 days.

Following the confirmation of the capacity of CHA-19 to use lignin as a growth substrate, lignin decomposition was examined using chromatography. After 15 days of incubation of CHA-19 cells with lignin, a small portion of the culture was centrifuged, and the supernatant was analyzed by GPC. Intact lignin, which was not treated with CHA-19 cells (control), was separated at a retention time (RT) of 5–20 min and determined to be 9.6–642.0 kDa in size, compared with the GPC elution profile of the pullulan standard. For the CHA-19-inoculated test sample, the lignin content significantly decreased by 45% (integrated peak area of 275,204 at 7–19 min) compared with that of the control (peak area of 613,435 at 5–20 min), which is indicative of the loss of the lignin fraction owing to CHA-19 decomposition (Fig. 1B).

Lignin Model Compound Degradation

To characterize the lignin decomposition strategies, the cleavage of certain lignin linkages was examined using the lignin model compounds, DDV and GGE. After DDV bioconversion using CHA-19 resting cells for 9 days, the reaction solution was analyzed using HPLC. As shown in Fig. 2A, the DDV peak at an RT of 18.3 min almost disappeared, producing novel distinct peaks at RTs of 11.4, 15.3, and 21.8 min. This suggests that the presence of an enzyme system involved in DDV degradation and that the novel peaks are the products of the enzymatic degradation reaction. The 11.4-min peak area largely increased with incubation time, whereas the others rarely changed in their RT and peak area (data not shown). These more hydrophilic novel compounds at 11.4 and 15.3 min were assumed to be vanillic acid (9.7 min) and vanillin (12.9 min), possible metabolites through bacterial DDV bioconversion [18]; however, their RTs were not consistent with that of respective authentic compound. The DDV-derived metabolites, vanillic acid and vanillin, might have been converted to unknown dead-end products, which were not further catabolized by CHA-19. In contrast to DDV, GGE incubated with CHA-19 cells rarely changed their RT and peak area after 9 days of reaction, compared with the no-cell control (Fig. 2B), which indicated that the enzymatic system for GGE degradation was either absent or expressed at a very low level in CHA-19 cells.

Figure 2. High-performance liquid chromatography elution profile of metabolites formed after (A) dehydrodivanillin (DDV) and (B) guaiacylglycerol β-guaiacyl ether (GGE) incubation with Pseudomonas kribbensis CHA-19 resting cells at 28°C for 9 days.

The β-aryl ether (including GGE) and biphenyl (including DDV) structures are dimeric compounds that are dominantly found in native polymeric lignin, accounting for 51% and 11%, respectively [19]. Each has been used as a model for characterization of different enzymatic reactions involving lignin decomposition. The distinct enzymes and pathways involved in the degradation of β-aryl ether (LigDD2, LigEF, and LigG) and biphenyl (LigX, LigZ, LigY, and LigWW2) structures to vanillin and/or vanillic acid are well identified and characterized in Sphingomonas paucimobilis SYK-6 [19]. The resulting vanillin and vanillic acid can be converted to each other by a reversible enzymatic reaction [18]. Considering that CHA-19 is able to grow on vanillic acid, low expressions of the catabolic enzymes for GGE degradation pathway seem to be more reasonable for CHA-19.

Identification of Lignin-Degradative Enzyme Genes Using Bioinformatic Analysis

Many lignin-degrading bacteria, including diverse genera, utilize oxidative enzymes such as DyPs and LMCOs to cleave C–C and C–O–C linkages within polymeric lignin or lignin model compounds. Genes for either DyPs [8] or LMCOs [20] frequently exist in multiple forms; however, the precise roles of different isoenzymes or genes remain largely unknown. Some bacteria were identified to possess multiple genes for both the enzymes, possibly for efficient lignin oxidation in their single host [1, 12, 14].

Gene annotation of the CHA-19 genome (approximately 6.4 Mb) revealed 5,737 coding sequences, of which several putative HA-degradative genes were detected and used to propose an HA-degradation pathway [17]: LMCOs (GenBank Accession Nos. TFH77958 and TFH78995), DyPs (GenBank Accession Nos. TFH80052, TFH80975, and TFH81056), protocatechuate 3,4-dioxygenase (P34O; GenBank accession no. TFH82233), and catechol 1,2-dioxygenase (C12O; GenBank Accession No. TFH78177). Based on the structural similarity between HA and lignin and the presence of main lignin components (especially guaiacol) in the HA structure, the LMCO-and DyP-annotated genes were assumed to be involved in the initial lignin oxidative degradation, with P34O- and C12O-annotated genes performing aromatic ring cleavage of lignin-derived small metabolites. The operonic structures of these genes and other neighboring genes and their predicted functions are depicted and summarized in Fig. 3A and Table 1. Several studies reported on bacterial laccase, LMCOs, and DyPs that initiate the lignin decomposition via β-O-4 ether bond cleavage in lignin [10, 21, 22]. Bacterial DyPs were characterized to cleave Cα–Cβ bond in β-aryl ether structures (e.g., GGE) within lignin polymer, finally producing small-molecular-weight, lignin-derived compounds, such as guaiacol and vanillin as main metabolites [8, 23]. Some bacterial lignin catabolic pathways lead to the production of vanillin or its oxidation product vanillic acid, which is converted to protocatechuic acid and can be degraded via oxidative ortho-ring cleavage using P34O. In an alternative pathway, vanillic acid is decarboxylated to guaiacol, which is converted to catechol, the aromatic ring of which can be cleaved via meta-ring reacting with C12O.

Table 1 . Gene annotation of putative LMCOs & DyPs and neighboring proteins on strain CHA-19 genome..

Gene IDLength (aa)Best hit [bacterial or fungal source]aIdentity (%)
TFH77956318tRNA (mo5U34)-methyltransferase [Pseudomonas syringae pv. tomato]253/317 (80%)
TFH77957165tRNA-specific adenosine deaminase [Escherichia coli]73/143 (51%)
TFH77958458Copper oxidase [Pseudomonas parafulva]356/420 (85%)
TFH779591449Cytotoxic necrotizing factor [Yersinia pseudotuberculosis]85/405 (21%)
TFH77960525GMP synthase [Escherichia coli]383/525 (73%)
TFH78993221Ribonuclease I [Escherichia coli]47/206 (23%)
TFH78994160No significant similarity
TFH78995559Laccase [Botrytis aclada]102/290 (35%)
TFH78996285Copper resistance protein B [Escherichia coli]130/215 (60%)
TFH78997124Copper resistance protein C [Pseudomonas syringae]82/102 (80%)
TFH78998287No significant similarity
TFH79018282Cyclohexadienyl dehydratase [Pseudomonas aeruginosa]120/232 (52%)
TFH80048554AMP-dependent synthetase and ligase [Brucella canis]313/544 (58%)
TFH80049338AraC family transcriptional regulator [Pseudomonas aeruginosa]34/83 (41%)
TFH80050282No significant similarity
TFH80051399Iron uptake system protein EfeO [Escherichia coli]132/324 (41%)
TFH80052432Peroxidase EfeB [Sphingomonas sp.]280/380 (74%)
TFH80053274Efem M75 Peptidase [Pseudomonas syringae pv. syringae]221/255 (87%)
TFH80054447Phosphatidylserine synthase [Haemophilus influenzae]215/443 (49%)
TFH80055188Putative TetR-family transcriptional regulator [Streptomyces avermitilis]52/169 (31%)
TFH80973315No significant similarity
TFH80974344AraC family transcriptional regulator [Pseudomonas aeruginosa]33/84 (39%)
TFH80975296Dyp-type peroxidase family protein [Pseudomonas putida]185/289 (64%)
TFH809763221,5-Anhydro-D-fructose reductase [Sinorhizobium meliloti]93/267 (35%)
TFH80977250HTH-type transcriptional repressor YvoA [Bacillus subtilis]73/241 (30%)
TFH80978576α-Subunit of PAPS reductase [Methanothermococcus thermolithotrophicus]160/539 (30%)
TFH8097981β-Subunit of PAPS reductase [Methanothermococcus thermolithotrophicus]20/59 (34%)
TFH80896262ROB transcription factor [Escherichia coli]30/99 (30%)
TFH80895570Type six secretion system exported effector 8 [Pseudomonas aeruginosa]500/568 (88%)
TFH81056311Putative iron-dependent peroxidase [Streptomyces lividans]189/313 (60%)
TFH80894325No significant similarity
TFH80893366Polyamine transport protein [Pseudomonas aeruginosa]194/345 (56%)
TFH80892468No significant similarity
TFH80891161Flavin reductase-like, FMN-binding protein [Mycolicibacterium thermoresistibile]58/153 (38%)
TFH80890347Luciferase-like monooxygenase [Streptomyces bottropensis]98/347 (28%)

aThe query sequences were searched against Protein Data Bank (PDB) database using NCBI Blastx program..
Figure 3. (A) Operonic structure of putative genes for initial lignin oxidative enzymes and neighboring proteins on Pseudomonas kribbensis CHA-19 genome. The gene IDs for dye-decolorizing peroxidase (DyP; TFH80052, TFH80975, and TFH81056) and laccase-like multicopper oxidases (LMCO; TFH77958 and TFH78995) are shown in red letters. (B) Comparison of mRNA expression levels of target genes in CHA-19 cells induced by vanillic acid (Van) or lignin (Lig) with those by glucose (Glu). mRNAs were extracted from the CHA-19 cells after 5- or 24-h induction at 28°C.

Targeted mRNA Analysis for Lignin Decomposition

To quantitatively analyze the expression levels of specific genes predicted to be involved in lignin decomposition and lignin metabolite degradation, the putative LMCO, DyP, P34O, and C12O genes were induced in CHA-19 cells by incubation with lignin or vanillic acid. Subsequently, real-time quantitative PCR was performed using the mRNA from individually induced cells. As shown in Fig. 3B and Table 2, when CHA-19 cells were induced with lignin for 5 h, the mRNA expression levels of two LMCO genes were significant (expression fold change, 3.4–3.7) compared with glucose-induced cells, and the fold change increased considerably to 5.6–7.9 after 24-h induction. The expression patterns of the P34O and C12O genes were similar to those of the LMCO genes (i.e., higher expression with an increase in induction time). Three DyP genes were more significantly expressed (fold change, 2.0–6.4) after 24 h than after 5 h. In summary, all genes tested were distinctly expressed, indicating their involvement in polymeric lignin decomposition. Remarkably, the mRNA expression levels of the LMCO and P34O genes in vanillic acid-induced cells remained high (expression fold change, >1.8) from 5 to 24 h, which is indicative of their main functions in lignin decomposition.

Table 2 . Fold changes in mRNA expressions of strain CHA-19 genes involved in the decomposition of lignin and its related compounds..

InductionTFH80052 (DyP)TFH80975 (DyP)TFH81056 (DyP)TFH77958 (LMCO)TFH78995 (LMCO)TFH82233 (P34O)TFH78177 (C12O)
TimeSubstrate
5-hGlu1.0 (± 0.1)a1.0 (± 0.1)1.0 (± 0.3)1.0 (± 0.1)1.0 (± 0.1)1.0 (± 0.1)1.0 (± 0.1)
Van1.5 (± 0.1)0.6 (± 0.1)0.9 (± 0.2)2.5 (± 0.1)2.2 (± 0.3)2.5 (± 0.1)1.3 (± 0.1)
Lig1.9 (± 0.1)1.0 (± 0.1)1.4 (± 0.7)3.4 (± 0.4)3.7 (± 0.8)3.1 (± 0.6)1.8 (± 0.1)
24-hGlu1.0 (± 0.2)1.0 (± 0.0)1.0 (± 0.0)1.0 (± 0.2)1.0 (± 0.0)1.0 (± 0.1)1.0 (± 0.1)
Van2.2 (± 1.0)1.8 (± 0.1)0.9 (± 0.1)1.8 (± 0.1)2.6 (± 0.3)2.1 (± 0.3)1.7 (± 0.1)
Lig6.4 (± 1.8)5.4 (± 0.1)2.0 (± 0.5)5.6 (± 0.7)7.9 (± 0.9)6.5 (± 0.4)3.7 (± 0.3)

aThe fold change values from qPCR results are mean (± standard deviation) of three technical replicate. Higher than 2.0-fold changes are highlighted in bold. Abbreviations: Glu, glucose; Van, vanillic acid; Lig, lignin..

Functional Prediction of DyPs and LMCOs for Initial Lignin Decomposition

To gain a deeper insight into the function of LMCOs and DyPs from CHA-19, we used local alignments using well-known databases and computer-aided enzyme modeling. DyP enzymes belong to a family of heme peroxidases, which are mainly derived from fungal sources and have wide substrate specificity. DyPs have been found in a variety of organisms, functioning in a wide cellular distribution range, from intracellular to extracellular, including the periplasmic space. In the RedoxiBase database [24], DyPs are categorized as classes A, B, C, and D by primary sequence homology. Recently, these DyP groups were reclassified as classes I, P, and V, respectively, using the multiple three-dimensional alignment tool [25]. In the new classification, the three DyPs (TFH80052, TFH80975, and TFH81056) from CHA-19 were classified into subclasses I3, P3, and P4, respectively (Fig. 4). Class I DyPs found in bacteria have twin arginine translocation (Tat) signal sequences that are exported into the periplasmic space. TFH80052 also has a predicted N-terminal Tat sequence, which has a high sequence identity with EfeB from Escherichia coli. The Efe system is a mechanism for siderophore-independent iron uptake induced by low pH or iron concentrations [26]. On the CHA-19 genome, we also found an EfeO homologue (TFH80051) related to the Efe system (Table 1). EfeB has bifunctional catalytic properties, with guaiacol peroxidase activity at low pH [27]. Lignin decomposition by class I DyPs has been reported for bacterial enzymes, such as DyPA from Pseudomonas fluorescens pf-5 [9], TfuDyP from Thermobifida fusca [28], and SviDyP from Saccharomonospora viridis DSM43017 [29]. Although TFH80052 and TFH81056 have putative signal peptides, we could not identify a signal peptide in TFH80975 using SignalP analysis [30]. TFH80975 is highly similar to PpDyP (DyP from Pseudomonas putida), which has high catalytic activity against lignin-related phenolic compounds. Recombinant PpDyP was expressed as a homotetramer. TFH81056 contains the Sec signal sequence and has 59% identity with DyPB from Rhodococcus jostii RHA1, which catalyzes the oxidative degradation of kraft lignin [8]. RHA1 contains two DyPs (DyPA and DyPB). DyPA is highly similar to TFH80052, which has been identified as class I. DyPB is expressed as a cargo enzyme in encapsulin, a self-assembling protein nanocompartment [31]. However, we found no encapsulation-related genes in the vicinity of TFH81056 in the CHA-19 genome.

Figure 4. Phylogenetic tree and structure models of three DyPs expressed in Pseudomonas kribbensis CHA-19. (A) Phylogenetic analysis of the CHA-19 DyPs (TFH80052, TFH80975, and TFH81056). Multiple sequence alignment of the proteins was performed using ClustalW. The sequences represented by NCBI reference number were used for phylogenetic analysis. The phylogenetic tree construction from the aligned sequences was performed using MEGA 11. The phylogenetic tree was visualized using iTOL version 6. EfeB from Escherichia coli, PpDyP from Pseudomonas putida, and DyPB from Rhodococcus jostii RHA1 are shown as representative enzymes of the subclasses I3, P3, and P4, respectively. (B) Overall structure of the CHA-19 DyPs predicted by ColabFold platform. Left, predicted multimer structure of each protein; middle, superimposition of the predicted DyPs structures with their corresponding proteins, EfeB (PDB ID: 3O72), PpDyP (PDB ID: 7QYQ), and DyPB (PDB ID: 3QNS); right, zoom-in view of the heme active site. The heme site structures are shown as stick and sphere models. The water molecule is depicted as a cyan sphere. The active site residues have hydrogen bond interaction with heme molecule in PDB data of DyPs.

MCO is a superfamily of oxidoreductases that catalyze the catalytic oxidation of various substrates, including phenolic compounds and polyphenols such as lignin. LMCO is a specific member of the MCO family that plays an important role in the lignin degradation pathway. Bioinformatics analysis of lignin-degrading bacteria, including RHA1, revealed that their genomes contain putative MCO and DyP genes [32]. CHA-19 cells distinctly expressed two LMCO genes, TFH77958 and TFH78995, upon induction by lignin or lignin-derived vanillic acid (Table 2). This suggests that both genes are involved in the lignin decomposition flux. Based on the classification of MCOs [32], phylogenetic analysis categorized TFH77958 and TFH78995 into groups A and C, respectively (Fig. 5A and 5B). TFH77958 was identified as a group A blue laccase enzyme known to oxidize lignin and its derivatives. Some group C enzymes, likely colorless pseudo-laccases, are known to be involved in copper homeostasis. Compared with studies on the function and diversity of fungal LMCOs, little is known about bacterial LMCOs and their possible implication in lignin decomposition [20].

Figure 5. Phylogenetic analysis and structure prediction of two LMCOs expressed in Pseudomonas kribbensis CHA-19: (A) TFH77958 and (B) TFH78995. The phylogenetic tree was obtained by applying a neighbor-joining algorithm to the ClustalW multiple sequence alignment of MCOs. The protein structures of LMCOs were predicted by the ColabFold platform.

In conclusion, the synergistic decomposition of polymeric lignin by a fungal and bacterial consortium appears to occur in natural environments, including cold bipolar tundra soils. Smaller lignin fractions produced through microbial decomposition should be examined in terms of lignin valorization to produce value-added chemicals. Until now, evidence that bacterial enzymes play a more significant role in lignin decomposition than their fungal counterparts has been insufficient and ambiguous. Overall, combined with the fact that CHA-19 can grow on polymeric lignin and lignin-derived small metabolites (phenol, benzoic acid, ferulic acid, and vanillic acid), the spectroscopic data presented here rigorously corroborate the ability of CHA-19 to decompose lignin and lignin model compounds (DDV). CHA-19 seems to prefer LMCOs for initial oxidative lignin decomposition to DyPs, producing smaller metabolites, such as vanillic acid, which is further degraded via a P34O-assisted aromatic ring cleavage pathway (Table 2 and Fig. 6). Studies at the bacterial single-cell level are essential for determining the complexities of lignin decomposition; nevertheless, these approaches have limitations regarding the entire function of bacterial communities in natural environments. However, this study helps to better understand the role of bacteria in lignin decomposition, and thus in terrestrial ecosystems, thereby expanding the biocatalytic toolbox with new bacterial cells and their degradative enzymes for lignin valorization.

Figure 6. Proposed lignin decomposition pathway (vanillic acid route) in Pseudomonas kribbensis CHA-19. Dotted and solid lines represent multistep reactions by different enzymes and one-step reaction by one enzyme, respectively.

Abbreviations

CFU, colony-forming units per milliliter

DDV, dehydrodivanillin

DyPs, dye-decolorizing peroxidases

GGE, guaiacylglycerol β-guaiacyl ether

GPC, gel permeation chromatography

HA, humic acids

HPLC, high-performance liquid chromatography LMCOs, laccase-like multicopper oxidases MCOs, multicopper oxidases

MSB, mineral salts base

RT, retention time

Tat, twin arginine translocation

Acknowledgments

This work was supported by a Korea Polar Research Institute (KOPRI) grant funded by the Ministry of Oceans and Fisheries (KOPRI PE24130).

Author Contributions

Dockyu Kim: Conceptualization, Investigation, Formal analysis, Writing–original draft, Writing–review & editing

Han-Woo Kim: Conceptualization, Formal analysis, Writing–original draft, Writing–review & editing Hyoungseok Lee: Funding acquisition, Writing - review & editing

Conflict of Interest

The authors have no financial conflicts of interest to declare.

Fig 1.

Download
Figure 1.(A) Viability over incubation time of Pseudomonas kribbensis CHA-19 at 28°C for 25 days. (B) Gel permeation chromatography elution profile of polymeric lignin after incubation with CHA-19 resting cells at 28°C for 15 days.
Journal of Microbiology and Biotechnology 2024; 34: 1867-1875https://doi.org/10.4014/jmb.2406.06021

Fig 2.

Download
Figure 2.High-performance liquid chromatography elution profile of metabolites formed after (A) dehydrodivanillin (DDV) and (B) guaiacylglycerol β-guaiacyl ether (GGE) incubation with Pseudomonas kribbensis CHA-19 resting cells at 28°C for 9 days.
Journal of Microbiology and Biotechnology 2024; 34: 1867-1875https://doi.org/10.4014/jmb.2406.06021

Fig 3.

Download
Figure 3.(A) Operonic structure of putative genes for initial lignin oxidative enzymes and neighboring proteins on Pseudomonas kribbensis CHA-19 genome. The gene IDs for dye-decolorizing peroxidase (DyP; TFH80052, TFH80975, and TFH81056) and laccase-like multicopper oxidases (LMCO; TFH77958 and TFH78995) are shown in red letters. (B) Comparison of mRNA expression levels of target genes in CHA-19 cells induced by vanillic acid (Van) or lignin (Lig) with those by glucose (Glu). mRNAs were extracted from the CHA-19 cells after 5- or 24-h induction at 28°C.
Journal of Microbiology and Biotechnology 2024; 34: 1867-1875https://doi.org/10.4014/jmb.2406.06021

Fig 4.

Download
Figure 4.Phylogenetic tree and structure models of three DyPs expressed in Pseudomonas kribbensis CHA-19. (A) Phylogenetic analysis of the CHA-19 DyPs (TFH80052, TFH80975, and TFH81056). Multiple sequence alignment of the proteins was performed using ClustalW. The sequences represented by NCBI reference number were used for phylogenetic analysis. The phylogenetic tree construction from the aligned sequences was performed using MEGA 11. The phylogenetic tree was visualized using iTOL version 6. EfeB from Escherichia coli, PpDyP from Pseudomonas putida, and DyPB from Rhodococcus jostii RHA1 are shown as representative enzymes of the subclasses I3, P3, and P4, respectively. (B) Overall structure of the CHA-19 DyPs predicted by ColabFold platform. Left, predicted multimer structure of each protein; middle, superimposition of the predicted DyPs structures with their corresponding proteins, EfeB (PDB ID: 3O72), PpDyP (PDB ID: 7QYQ), and DyPB (PDB ID: 3QNS); right, zoom-in view of the heme active site. The heme site structures are shown as stick and sphere models. The water molecule is depicted as a cyan sphere. The active site residues have hydrogen bond interaction with heme molecule in PDB data of DyPs.
Journal of Microbiology and Biotechnology 2024; 34: 1867-1875https://doi.org/10.4014/jmb.2406.06021

Fig 5.

Download
Figure 5.Phylogenetic analysis and structure prediction of two LMCOs expressed in Pseudomonas kribbensis CHA-19: (A) TFH77958 and (B) TFH78995. The phylogenetic tree was obtained by applying a neighbor-joining algorithm to the ClustalW multiple sequence alignment of MCOs. The protein structures of LMCOs were predicted by the ColabFold platform.
Journal of Microbiology and Biotechnology 2024; 34: 1867-1875https://doi.org/10.4014/jmb.2406.06021

Fig 6.

Download
Figure 6.Proposed lignin decomposition pathway (vanillic acid route) in Pseudomonas kribbensis CHA-19. Dotted and solid lines represent multistep reactions by different enzymes and one-step reaction by one enzyme, respectively.
Journal of Microbiology and Biotechnology 2024; 34: 1867-1875https://doi.org/10.4014/jmb.2406.06021

Table 1 . Gene annotation of putative LMCOs & DyPs and neighboring proteins on strain CHA-19 genome..

Gene IDLength (aa)Best hit [bacterial or fungal source]aIdentity (%)
TFH77956318tRNA (mo5U34)-methyltransferase [Pseudomonas syringae pv. tomato]253/317 (80%)
TFH77957165tRNA-specific adenosine deaminase [Escherichia coli]73/143 (51%)
TFH77958458Copper oxidase [Pseudomonas parafulva]356/420 (85%)
TFH779591449Cytotoxic necrotizing factor [Yersinia pseudotuberculosis]85/405 (21%)
TFH77960525GMP synthase [Escherichia coli]383/525 (73%)
TFH78993221Ribonuclease I [Escherichia coli]47/206 (23%)
TFH78994160No significant similarity
TFH78995559Laccase [Botrytis aclada]102/290 (35%)
TFH78996285Copper resistance protein B [Escherichia coli]130/215 (60%)
TFH78997124Copper resistance protein C [Pseudomonas syringae]82/102 (80%)
TFH78998287No significant similarity
TFH79018282Cyclohexadienyl dehydratase [Pseudomonas aeruginosa]120/232 (52%)
TFH80048554AMP-dependent synthetase and ligase [Brucella canis]313/544 (58%)
TFH80049338AraC family transcriptional regulator [Pseudomonas aeruginosa]34/83 (41%)
TFH80050282No significant similarity
TFH80051399Iron uptake system protein EfeO [Escherichia coli]132/324 (41%)
TFH80052432Peroxidase EfeB [Sphingomonas sp.]280/380 (74%)
TFH80053274Efem M75 Peptidase [Pseudomonas syringae pv. syringae]221/255 (87%)
TFH80054447Phosphatidylserine synthase [Haemophilus influenzae]215/443 (49%)
TFH80055188Putative TetR-family transcriptional regulator [Streptomyces avermitilis]52/169 (31%)
TFH80973315No significant similarity
TFH80974344AraC family transcriptional regulator [Pseudomonas aeruginosa]33/84 (39%)
TFH80975296Dyp-type peroxidase family protein [Pseudomonas putida]185/289 (64%)
TFH809763221,5-Anhydro-D-fructose reductase [Sinorhizobium meliloti]93/267 (35%)
TFH80977250HTH-type transcriptional repressor YvoA [Bacillus subtilis]73/241 (30%)
TFH80978576α-Subunit of PAPS reductase [Methanothermococcus thermolithotrophicus]160/539 (30%)
TFH8097981β-Subunit of PAPS reductase [Methanothermococcus thermolithotrophicus]20/59 (34%)
TFH80896262ROB transcription factor [Escherichia coli]30/99 (30%)
TFH80895570Type six secretion system exported effector 8 [Pseudomonas aeruginosa]500/568 (88%)
TFH81056311Putative iron-dependent peroxidase [Streptomyces lividans]189/313 (60%)
TFH80894325No significant similarity
TFH80893366Polyamine transport protein [Pseudomonas aeruginosa]194/345 (56%)
TFH80892468No significant similarity
TFH80891161Flavin reductase-like, FMN-binding protein [Mycolicibacterium thermoresistibile]58/153 (38%)
TFH80890347Luciferase-like monooxygenase [Streptomyces bottropensis]98/347 (28%)

aThe query sequences were searched against Protein Data Bank (PDB) database using NCBI Blastx program..

Table 2 . Fold changes in mRNA expressions of strain CHA-19 genes involved in the decomposition of lignin and its related compounds..

InductionTFH80052 (DyP)TFH80975 (DyP)TFH81056 (DyP)TFH77958 (LMCO)TFH78995 (LMCO)TFH82233 (P34O)TFH78177 (C12O)
TimeSubstrate
5-hGlu1.0 (± 0.1)a1.0 (± 0.1)1.0 (± 0.3)1.0 (± 0.1)1.0 (± 0.1)1.0 (± 0.1)1.0 (± 0.1)
Van1.5 (± 0.1)0.6 (± 0.1)0.9 (± 0.2)2.5 (± 0.1)2.2 (± 0.3)2.5 (± 0.1)1.3 (± 0.1)
Lig1.9 (± 0.1)1.0 (± 0.1)1.4 (± 0.7)3.4 (± 0.4)3.7 (± 0.8)3.1 (± 0.6)1.8 (± 0.1)
24-hGlu1.0 (± 0.2)1.0 (± 0.0)1.0 (± 0.0)1.0 (± 0.2)1.0 (± 0.0)1.0 (± 0.1)1.0 (± 0.1)
Van2.2 (± 1.0)1.8 (± 0.1)0.9 (± 0.1)1.8 (± 0.1)2.6 (± 0.3)2.1 (± 0.3)1.7 (± 0.1)
Lig6.4 (± 1.8)5.4 (± 0.1)2.0 (± 0.5)5.6 (± 0.7)7.9 (± 0.9)6.5 (± 0.4)3.7 (± 0.3)

aThe fold change values from qPCR results are mean (± standard deviation) of three technical replicate. Higher than 2.0-fold changes are highlighted in bold. Abbreviations: Glu, glucose; Van, vanillic acid; Lig, lignin..

References

  1. Granja-Travez RS, Bugg TDH. 2018. Characterization of multicopper oxidase CopA from Pseudomonas putida KT2440 and Pseudomonas fluorescens Pf-5: involvement in bacterial lignin oxidation. Arch. Biochem. Biophys. 660: 97-107.
    Pubmed CrossRef
  2. Bruijnincx PCA, Rinaldi R, Weckhuysen BM. 2015. Unlocking the potential of a sleeping giant: lignins as sustainable raw materials for renewable fuels, chemicals and materials. Green Chem. 17: 4860-4861.
    CrossRef
  3. Kamimura N, Sakamoto S, Mitsuda N, Masai E, Kajita S. 2019. Advances in microbial lignin degradation and its applications. Curr. Opin. Biotechnol. 56: 179-186.
    Pubmed CrossRef
  4. Hermosilla E, Schalchli H, Mutis A, Diez MC. 2017. Combined effect of enzyme inducers and nitrate on selective lignin degradation in wheat straw by Ganoderma lobatum. Environ. Sci. Pollut. Res. 24: 21984-21996.
    Pubmed CrossRef
  5. Sainsbury PD, Hardiman EM, Ahmad M, Otani H, Seghezzi N, Eltis LD, et al. 2013. Breaking down lignin to high-value chemicals: the conversion of lignocellulose to vanillin in a gene deletion mutant of Rhodococcus jostii RHA1. ACS Chem. Biol. 8: 2151-2156.
    Pubmed CrossRef
  6. Xu Z, Qin L, Cai M, Hua W, Jin M. 2018. Biodegradation of kraft lignin by newly isolated Klebsiella pneumoniae, Pseudomonas putida, and Ochrobactrum tritici strains. Environ. Sci. Pollut. Res. 25: 14171-14181.
    Pubmed CrossRef
  7. Tian JH, Pourcher AM, Klingelschmitt F, Le Roux S, Peu P. 2016. Class P dye-decolorizing peroxidase gene: degenerated primers design and phylogenetic analysis. J. Microbiol. Methods 130: 148-153.
    Pubmed CrossRef
  8. Ahmad M, Roberts JN, Hardiman EM, Singh R, Eltis LD, Bugg TD. 2011. Identification of DypB from Rhodococcus jostii RHA1 as a lignin peroxidase. Biochemistry 50: 5096-5107.
    Pubmed CrossRef
  9. Rahmanpour R, Bugg TD. 2015. Characterisation of dyp-type peroxidases from Pseudomonas fluorescens Pf-5: oxidation of Mn(II) and polymeric lignin by Dyp1B. Arch. Biochem. Biophys. 574: 93-98.
    Pubmed CrossRef
  10. Yang J, Gao T, Zhang Y, Wang S, Li H, Li S, et al. 2019. Degradation of the phenolic β-ether lignin model dimer and dyes by dyedecolorizing peroxidase from Bacillus amyloliquefaciens. Biotechnol. Lett. 41: 1015-1021.
    Pubmed CrossRef
  11. Majumdar S, Lukk T, Solbiati JO, Bauer S, Nair SK, Cronan JE, et al. 2014. Roles of small laccases from Streptomyces in lignin degradation. Biochemistry 53: 4047-4058.
    Pubmed CrossRef
  12. Kim D, Park HJ, Sul WJ, Park H. 2018. Transcriptome analysis of Pseudomonas sp. from subarctic tundra soil: pathway description and gene discovery for humic acids degradation. Folia Microbiol (Praha). 63: 315-323.
    Pubmed CrossRef
  13. Park HJ, Lee YM, Do H, Lee JH, Kim E, Lee H, et al. 2021. Involvement of laccase-like enzymes in humic substance degradation by diverse polar soil bacteria. Folia Microbiol (Praha) 66: 331-340.
    Pubmed CrossRef
  14. Rashid GMM, Sodre V, Luo J, Bugg TDH. 2024. Overexpression of endogenous multi-copper oxidases mcoA and mcoC in Rhodococcus jostii RHA1 enhances lignin bioconversion to 2,4-pyridine-dicarboxylic acid. Biotechnol. Bioeng. 121: 1366-1370.
    Pubmed CrossRef
  15. Picart P, Muller C, Mottweiler J, Wiermans L, Bolm C, Dominguez de Maria P, et al. 2014. From gene towards selective biomass valorization: bacterial β-etherases with catalytic activity on lignin-like polymers. ChemSusChem 7: 3164-3171.
    Pubmed CrossRef
  16. Husarcikova J, Voss H, Dominguez de Maria P, Schallmey A. 2018. Microbial β-etherases and glutathione lyases for lignin valorisation in biorefineries: current state and future perspectives. Appl. Microbiol. Biotechnol. 102: 5391-5401.
    Pubmed CrossRef
  17. Kim D, Lee H. 2019. Draft genome sequence of humic substances-degrading Pseudomonas kribbensis CHA-19 from temperate forest soil. Korean J. Microbiol. 55: 177-179.
  18. Chen W, Ohmori M, Ohmiya K, Shimizu S. 1988. Enzymatic conversion of dehydrodivanillin to vanillin by an anaerobic recombinant FE7. J. Ferment. Technol. 66: 341-346.
    CrossRef
  19. Masai E, Katayama Y, Fukuda M. 2007. Genetic and biochemical investigations on bacterial catabolic pathways for lignin-derived aromatic compounds. Biosci. Biotechnol. Biochem. 71: 1-15.
    Pubmed CrossRef
  20. Kellner H, Luis P, Zimdars B, Kiesel B, Buscot F. 2008. Diversity of bacterial laccase-like multicopper oxidase genes in forest and grassland cambisol soil samples. Soil Biol. Biochem. 40: 638-648.
    CrossRef
  21. Freedman Z, Zak DR. 2014. Atmospheric N deposition increases bacterial laccase-like multicopper oxidases: implications for organic matter decay. Appl. Environ. Microbiol. 80: 4460-4468.
    Pubmed KoreaMed CrossRef
  22. Zhu D, Liang N, Zhang R, Ahmad F, Zhang W, Yang B, et al. 2020. Insight into depolymerization mechanism of bacterial laccase for lignin. ACS Sustain. Chem. Eng. 8: 12920-12933.
    CrossRef
  23. Lin L, Cheng Y, Pu Y, Sun S, Li X, Jin M, et al. 2016. Systems biology-guided biodesign of consolidated lignin conversion. Green Chem. 18: 5536-5547.
    CrossRef
  24. Savelli B, Li Q, Webber M, Jemmat AM, Robitaille A, Zamocky M, et al. 2019. Redoxibase: a database for ROS homeostasis regulated proteins. Redox Biol. 26: 101247.
    Pubmed KoreaMed CrossRef
  25. Yoshida T, Sugano Y. 2015. A structural and functional perspective of dyp-type peroxidase family. Arch. Biochem. Biophys. 574: 49-55.
    Pubmed CrossRef
  26. Nakatsuji S, Okumura K, Takase R, Watanabe D, Mikami B, Hashimoto W. 2022. Crystal structures of EfeB and EfeO in a bacterial siderophore-independent iron transport system. Biochem. Biophys. Res. Commun. 594: 124-130.
    Pubmed CrossRef
  27. Liu X, Du Q, Wang Z, Zhu D, Huang Y, Li N, et al. 2011. Crystal structure and biochemical features of EfeB/YcdB from Escherichia coli O157: Asp235 plays divergent roles in different enzyme-catalyzed processes. J. Biol. Chem. 286: 14922-14931.
    Pubmed KoreaMed CrossRef
  28. van Bloois E, Torres Pazmino DE, Winter RT, Fraaije M.W. 2010. A robust and extracellular heme-containing peroxidase from Thermobifida fusca as prototype of a bacterial peroxidase superfamily. Appl. Microbiol. Biotechnol. 86: 1419-1430.
    Pubmed KoreaMed CrossRef
  29. Yu W, Liu W, Huang H, Zheng F, Wang X, Wu Y, et al. 2014. Application of a novel alkali-tolerant thermostable DyP-type peroxidase from Saccharomonospora viridis DSM 43017 in biobleaching of eucalyptus kraft pulp. PLoS One 9: e110319.
    Pubmed KoreaMed CrossRef
  30. Teufel F, Almagro Armenteros JJ, Johansen AR, Gislason MH, Pihl SI, Tsirigos KD, et al. 2022. Signalp 6.0 predicts all five types of signal peptides using protein language models. Nat. Biotechnol. 40: 1023-1025.
    Pubmed KoreaMed CrossRef
  31. Rahmanpour R, Bugg TD. 2013. Assembly in vitro of Rhodococcus jostii RHA1 encapsulin and peroxidase DypB to form a nanocompartment. FEBS J. 280: 2097-2104.
    Pubmed CrossRef
  32. Granja-Travez RS, Persinoti GF, Squina FM, Bugg TDH. 2020. Functional genomic analysis of bacterial lignin degraders: diversity in mechanisms of lignin oxidation and metabolism. Appl. Microbiol. Biotechnol. 104: 3305-3320.
    Pubmed CrossRef