Yersinia enterocolitica is a Gram-negative, food-borne, zoonotic pathogen with worldwide distribution [1]. It is the causative agent of yersiniosis, which is mainly characterized by gastrointestinal disorders; however, extraintestinal systemic manifestations and septic complications have also been recognized occasionally [2]. According to their biochemical features and pathogenic properties, Y. enterocolitica strains are divided into six biotypes: the highly pathogenic biotype 1B; the weakly pathogenic biotypes 2–5; and the non-pathogenic biotype 1A [3]. In addition, with regard to the antigenic scheme, more than 70 serotypes of Y. enterocolitica have been identified to date [4]. Among these, only 11 serotypes have been reported to be associated with human yersiniosis, with O:3, O:9, O:8 and O:5,27 being the most prevalent, according to clinical evidence [4, 5].

In Gram-negative bacteria, lipopolysaccharide (LPS) is a major component of the outer membrane. The full LPS molecule includes three structurally distinct regions: the lipid A; an oligosaccharide core; and the O-antigenic polysaccharide (O-antigen) [6]. The O-antigen is made of oligosaccharide repeats (O-units) each consisting of two to eight different monosaccharide residues (heteroglycans) or, in some bacteria, identical sugars (homoglycans)[7]. The O-antigen is the most variable LPS component in terms of composition and structure, and thus provides the molecular basis for serotyping, one of the main useful tools for epidemiological, diagnostic, and phylogenetic purposes [8]. Enzymes involved in O-antigen synthesis are encoded in a number of genes, which are always located within a chromosome-encoded locus, namely, the O-antigen gene cluster (O-AGC), and the high variability of O-antigens results normally from the genetic diversity of O-AGC [9,10]. The synthesis of O-antigen depends on one of two classical pathways: the Wzx/Wzy dependent pathway [11] and the ABC transporter (Wzm/Wzt) dependent pathway [12].

The O-antigen chemical structures have been reported for several Y. enterocolitica serotypes, including O:1 to O:3, O:5,27, O:6, and O:8 to O:10 [13-18], and the O-AGCs are known for serotypes O:3, O:9, O:8, O:5 and O:5,27 [19]. In serotype O:8, the O-AGC is located between the hemH and gsk genes. In other serotypes, however, the hemH-gsk locus is occupied by the outer core gene cluster, and the O-AGCs are located elsewhere, always along with several transposase genes; this probably indicates a hotspot region of lateral gene transfer [20, 21]. Since serotyping is one of the main characteristics of Y. enterocolitica, a number of PCR-based methods have been developed for the detection of clinically prevalent serotypes of Y. enterocolitica with higher efficiency and specificity based on the comprehensive elucidation of their O-AGCs [19, 22, 23]. In addition to the main serotypes which are strongly associated with human infection, a few minor serotypes have also been reported as causal agents in sporadic cases [24, 25].

Besides the O-antigen that has been demonstrated to be a virulence factor in Y. enterocolitica [26, 27], pathogenic Y. enterocolitica strains harbor many other chromosome- and plasmid-encoded virulence determinants that are essential for pathogenesis [28]. The main chromosomal virulence genes include the following: ail, encoding the protein which plays a key role during attachment and invasion processes, and which also confers serum resistance [29]; inv, whose product is required in the early phase of infection [30]; myfA, encoding a fibrillar submit of Myf, an important factor at the beginning of infection [31]; and yst, encoding an enterotoxin [32]. In addition, several genes located within a virulence plasmid, pYV, are directly involved in the pathogenicity of Y. enterocolitica, including yadA, encoding Yersinia adhesin, and the yop virulon genes, encoding a type III secretion system (T3SS), namely, Ysc-Yops, translocator YopB/D, control element YopN, and effector YopE/H/M/O/P/T [33]. Normally, high-virulence strains of biotypes 1B and low-virulence strains of biotypes 2–5 carry the chromosome-encoded virulence markers ail, inv, and ystA, in addition to pYV, for their full virulence expression. In contrast, nonvirulent strains belonging to biotype 1A lack pYV-encoding virulence factors, but mainly possess ystB, another type of yst gene [19]. Many studies showed that Y. enterocolitica strains of different biotypes exhibit disparate pathogenic properties and virulence profiles [34-36]. However, the link between serotypes and virulence gene distribution in Y. enterocolitica has not yet been reported.

During the routine epidemiological surveillance, a Y. enterocolitica strain, which was numbered WL-21, was isolated from the stool sample of a chicken by the Shandong Centre for Disease Control and Prevention. Further agglutination test by using antisera (provided by Chinese Center for Disease Control and Prevention) showed that WL-21 was serotype O:10, and biotyping test according to a previous study [37] showed that this isolate belonged to biotype 1A. As an uncommon serotype, neither the O-AGC nor the virulence patterns of O:10 was revealed. The first objective of the present study was to characterize the O-AGC of WL-21, and certify its role in O-antigen synthesis. Secondly, through comprehensive in silico analysis of the O-AGCs, we produced a blueprint that may contribute to elucidating the origin and evolution of O-AGC in Y. enterocolitica. Finally, we sought to recognize any interactions between O-antigen and other virulence factors in the pathogenicity of Y. enterocolitica.

Bacterial Strains, Plasmids, and Growth Conditions

Details of WL-21 and its derivatives, plasmids, and primers which were used in this study are given in Table 1. All strains used for sequencing and gene manipulation were cultured in Luria–Bertani (LB) medium at 30°C. When necessary, the cultures were supplemented with chloramphenicol (25 μg/ml).

Table 1 . Strains, plasmids, and primers used in this study..

Strain/plasmid/primer	Description
Strain
WL-21	Yersinia enterocolitica 1A/O:10
WL-21Δwzm	WL-21 wzm gene deletion
WL-21Δwzm::wzm	WL-21Δwzm complemented with pBAD33-wzm
S-17	Escherichia coli S17-1/λpir strain
Plasmid
pRE112	Allelic exchange vector with sacB, chloramphenicol resistant
pRE112-updown	pRE112 fused with WL-21 wzm up- and down- homologous sequences
pBAD33	araC, promoter PBAD, chloramphenicol resistant
pBAD33-wzm	pBAD33 inserted with WL-21 wzm gene
Primer	Nucleotide sequences (5'-3')a
112F	TACACTCGTTAGCATTTACCAGCACCCTGATAAATGCTTCAATAATGG, forward primer for pRE112 linearization
112R	TACAGCGGCTCCTACTGAGGGTCAACAGCTCATTTCAGAATGG, reverse primer for pRE112 linearization
upF	CCATTATTGAAGCATTTATCAGGGTGCTGGTAAATGCTAACGAGTGTA, forward primer for wzy upload sequence
upR	CTGAACCCACATAGGTAGAATAGATACACGAGCCACAGAGGTCCAAG, reverse primer for wzy upload sequence
downF	CTTGGACCTCTGTGGCTCGTGTATCTATTCTACCTATGTGGGTTCAG, forward primer for wzy download sequence
downR	CCATTCTGAAATGAGCTGTTGACCCTCAGTAGGAGCCGCTGTA, reverse primer for wzy download sequence
wzm-cF	CGGGGTACCAGGAGGAAAAGTGAAAGAGATGTTATTAGCGAT, forward primer for wzm cloning, digested with KnpI
wzm-cR	CCCAAGCTTTCATAATTCATCTACCATATCTTTG, reverse primer for wzm cloning, digested with HindIII

^aBoldface characters indicate the Shine–Dalgarno box, and restriction sites are in italics..

LB medium (Cat. no. R20214) and chloramphenicol (Cat. no. S17022) were purchased from YuanYe Bio-Technology Co., Ltd. (China). The DNA extraction kit (Cat. no. DP302-02) was purchased from Tiangen Biotech Co., Ltd. (China). High-Fidelity DNA Polymerase (Cat. no. M0530S), restriction enzymes (Cat. nos. R3142V and R3104V) and T4 DNA ligase (Cat. no. M0202V) were purchased from New England Biolab (USA). Sucrose (Cat. no. A610498), L-arabinose (Cat. no. A610071), and reagents for LPS preparation and sodium dodecyl sulphate–polyacrylamide gel electrophoresis (SDS-PAGE) were purchased from Sangon Co., Ltd. (China). Primers were synthesized by Genewiz (China).

Genome Sequencing and Annotation

The genomic DNA of Y. enterocolitica strain WL-21 was extracted from 5 ml of the overnight bacterial culture. Then, the genomic DNA was sheared, polished, and prepared using the Nextera XT DNA library prep kit (Illumina, USA). Genomic libraries containing 500-bp paired-end inserts were constructed, and sequencing was then performed using Solexa sequencing technologies (Illumina) to produce approximately 100-fold coverage. The obtained reads were assembled using the de novo genome assembly program Velvet to generate a multi-contig draft genome [38]. For gene prediction and annotation, Prokka (v1.12) was used [39], and for additional annotation, the assembled sequences were searched against GenBank non-redundant (NR), UniProt, and Pfam database using BLAST (v2.5.0+) [40]. The TMHMM v2.0 analysis program (http://www.cbs.dtu.dk/services/TMHMM-2.0/) was used to identify potential transmembrane domains within the protein sequences. The sequence data were submitted to GenBank under accession number PP132002. Meanwhile, the genome sequence of a strain IP2222 (O:36) was downloaded from GenBank (GCA_000285015.1) and annotated using the above procedures.

Construction of Plasmids and Strains

Gene deletion in the WL-21 chromosome was performed according to a two-step homologous recombination with pRE112 containing the sacB counter-selectable marker, as described previously [41]. The upstream and downstream fragments of the wzm gene were amplified from the WL-21 genome using primer pairs upF/upR and downF/downR. Next, the two fragments were combined with each other using primers upF and downR, followed by fusion with the linearized pRE112 to yield the suicide plasmid pRE112-updown, which was introduced into the S-17 strain by electroporation, generating the donor strain S-17-pRE112-updown. For conjugation, S-17-pRE112-updown and the recipient strain WL-21 were grown at 30°C with shaking overnight. Then, the cultures were diluted as a ratio of 1:100 into fresh LB medium and incubated at 30°C with shaking until the optical density at 600 nm (OD₆₀₀) reached approximately 0.6. Next, the donor and the recipient strains were mixed at a ratio of 3:1 (v/v), and the mixture was resuspended in 100 μl of LB medium and was spotted on a LB plate with incubation at 30°C for 48h. After conjugation, the cells were collected and transferred to chloramphenicol containing LB plate to screen for clones via a single crossover event. The growing clones were then transferred into fresh LB medium and incubated at 30°C overnight to induce the second homologous recombination. The overnight culture was diluted and spread on LB plates containing 10% sucrose and grown at 30°C for 24 h. Finally, the resultant clones were transferred onto LB plates and LB plates with chloramphenicol simultaneously, and clones sensitive to chloramphenicol were selected and confirmed by PCR and sequencing.

For the complementation test, the wzm gene was amplified from the WL-21 genome using primers wzm-cF and wzm-cR. The PCR fragment was digested with restriction enzymes KpnI and HindIII, and the digested fragment was cloned into pBAD33, which was also treated with the same enzymes, resulting in plasmid pBAD33-wzm. Expression of the cloned wzm gene is under the control of the P_BAD promoter, which could be activated by arabinose. Then, pBAD33-wzm was introduced into WL-21Δwzm by electroporation, generating the complementary strain WL-21Δwzm::wzm.

LPS Extraction and SDS-PAGE Analysis

Strains were grown overnight at 22°C with shaking, and cultures were diluted into 20 ml of fresh LB broth at a ratio of 1:100 and incubated at 22°C to mid-log phase at a final OD600 = 0.8. To induce wzm expression under the control of pBAD33, L-arabinose (0.5 mg/ml) was added to cultures at the OD₆₀₀ = 0.4, and the cultures were incubated continuously to mid-log phase at the OD₆₀₀ = 0.8. Then, LPS used for SDS-PAGE analysis was prepared using the hot aqueous-phenol method, as previously described [42]. The extracted LPSs were separated using 12%SDS-PAGE at 50 V for 30 min and 100 V for 2 h; subsequently, they were visualized by silver staining using the Fast Silver Stain Kit (Cat. no. P0017S; Beyotime, China), according to the manufacturer’s protocol. The gel image was captured using a GS900 calibrated densitometer (BioRad Laboratories, USA).

Analysis of Putative O-AGCs and Virulence Marker Profiles

Genomes of those isolates with the serotypes assigned to by the other submitters were downloaded from the GenBank database. Putative O-AGCs of serotypes were characterized using the in-house Bacterial Surface Polysaccharide Gene Database. In general, query genome sequences in GenBank format were searched against the database using BLASTp with the cutoff %coverage > 60 and %identity > 30. An O-AGC candidate could be defined using the following criteria: (1) the smallest number of successive genes is six; (2) the number of successive genes annotated “No hits” is no more than three; and (3) there must be glycosyl transferase gene(s), in addition to wzm/wzt or at least one of wzx and wzy genes. Schematic diagram of genes (Fig. 3) was generated using ChiPlot [43].

Figure 3. Representation of the O-antigen genetic clusters that have not been reported previously from uncommon serotypes. Gene names are given (where possible) for the schematic of each serotype, as well as the genetic locus tag of each strain being provided. Serotype names are indicated on the left, with strain names in the brackets. The O-antigen structures of O:1, O:2, O:3 [13], and O10 [18] are also shown. Regions conserved between strains are indicated as light pink blocks. ^aThe O:3 antigen gene cluster is drawn from nucleotide sequence under accession number Z118920; ^bThe genome of IP2222 (O:36) was annotated in this study; *Truncated gene.

The downloaded genome sequences, along with that of WL-21, were also compared with the selected virulence genes, including ail [29], inv [30], myfA [31], ystA/B [32], yadA and yop virulon [33], ymoA [44], yplA [45], fliA and flh/C/D [46], fyuA and ybtP/Q [47], and ysa genes [48], which have been identified previously. Nucleotide sequences were compared using BLASTn, and genes with >90% coverage match and >85% identity match were classified as present. Isolates were clustered according to their virulence profiles, and the pattern was visualized by ChiPlot [43].

The Putative O-AGC of WL-21 Correlates Well with the O-Antigen Structure of Y. enterocolitica O:10

The putative O-AGC of WL-21 is 16,137 bp in length, and consists of 11 open reading frames (orfs). These orfs were located between the dcuC and galU-galF genes, and the transcribed direction of orf2 to 11 was from dcuC to galU, with the exception of orf1 just downstream of dcuC (Fig. 1), in line with the evidence for O:3 and very similar to that for O:9.

Figure 1. Representation of the O-antigen genetic cluster of Y. enterocolitica WL-21, with the O-antigen structure of serotype O:10 [18] shown at the top (left), as well as the outer core gene cluster (right).

Details of proposed functions of the 11 orfs were summarized in Table 2. Orf1, a TerC family protein (Pfam03741), was assigned to the function of transporter in O:3 and O:8. TerC protein may be implicated in resistance to tellurium [49]; however, no involvement of this protein in O-antigen synthesis has yet been reported. Orf2, 3, 8, and 9 were annotated as mannose-1-phosphate guanylyltransferase (ManC), phosphoglucomutase (ManB), GDP-mannose 4,6-dehydratase (Gmd), and GDP-6-deoxy-D-talose 4-dehydrogenase (Rmd), respectively. These four enzymes, along with mannose-6-phosphate isomerase (ManA), whose coding gene is always outside the O-AGC, are responsible for the synthesis of GDP-D-rhamnose (GDP-D-Rhap), the nucleotide precursor of D-Rhap [50]. This is consistent with the existence of D-Rhap, which is the only sugar component in the backbone of O:10-antigen. Orf4 and 5 were proposed as the ABC transporter permease (Wzm) and the ABC transporter ATP-binding protein (Wzt), respectively, suggesting that it is very likely that the O-antigen of WL-21 was generated via the ABC transporter dependent pathway. orf6, just downstream of wzt, was annotated a methyltransferase gene. This is very common in O-AGCs containing wzm/wzt genes, and its function has been identified as adding a methyl group to the non-reducing terminus of the O-antigen, thus halting polymerization and regulating chain length [51, 52]. Finally, Orf7, 10, and 11 were all recognized as glycosyl transferases. These enzymes could presumably be involved in the sequential transfer of GDP-D-Rhap to D-Rhap polymers, forming the backbone, and the transfer of L-xylulose (L-Xulf) to D-Rhap, forming the side-chain linkage L-Xulf-(β2→2)-D-Rhap. However, the exact functions of these glycosyl transferases should be confirmed biochemically in the future.

Table 2 . Details of proposed functions of the putative WL-21 O-AGC..

orf No.	Gene name	Species (Accession No.)	% Identical/% Similar	Putative function of protein
1	orf1	Y. enterocolitica (WP_005168322.1)	99/100	TerC family protein
2	manC	Y. enterocolitica (WP_076707092.1)	98/99	Mannose-1-phosphate guanylyltransferase/ mannose-6-phosphate isomerase
3	manB	Y. enterocolitica (WP_077174857.1)	99/100	Phosphomannomutase
4	wzm	Y. enterocolitica (WP_260505577.1)	90/96	ABC transporter permease
5	wzt	Y. enterocolitica (WP_221866130.1)	91/95	ABC transporter ATP-binding protein
6	ubiG	Y. enterocolitica (WP_221866131.1)	70/81	Class I SAM-dependent methyltransferase
7	gtr1	Y. enterocolitica (WP_221866132.1 )	79/89	Glycosyltransferase family 1 protein
8	gmd	Y. enterocolitica (WP_221866133.1 )	98/99	GDP-mannose 4,6-dehydratase
9	rmd	Y. enterocolitica (WP_076707088.1 )	93/96	GDP-mannose 4,6-dehydratase
10	gtr2	Y. enterocolitica (WP_076707087.1 )	88/94	Glycosyltransferase family 1 protein
11	gtr3	HDL6886110.1 )	93/97	Glycosyltransferase family 4 protein

We also observed the hemH-gsk locus at the WL-21 genome (Fig. 1), within which the genetic organization was identical to the outer core gene clusters of O:3 and O:9. This finding also indicated that the genetic elements between dcuC and galU-galF were the candidates for WL-21 O-antigen synthesis genes.

Deletion and Complementation Test Confirmed the Functionality of WL-21 O-AGC

To confirm the role of dcuC-galU-galF locus in O-antigen synthesis, a wzm knockout strain WL-21Δwzm was constructed. As can obviously be seen in the LPS profile, the WL-21 wide-type strain exhibited a complete LPS, while WL-21Δwzm only generated an O-antigen-depleted LPS (Fig. 2). Within the ABC transporter dependent pathway, the translocation of O-antigen is mediated by the integral membrane protein (Wzm)/hydrophilic protein complex (Wzt) [53]. Therefore, WL-21Δwzm lost the ability to produce the Wzm/Wzt complex for O-antigen translocation, thus only the lipid A-core band was generated without O-antigen. Moreover, the complete LPS profile could be restored from the wzm complemented strain, WL-21Δwzm::wzm. However, we noticed that the chain-length of O-anitgen increased slightly in WL-21Δwzm::wzm compared to that in the wide type strain (Fig. 2). There is no clear-cut explanation, as polysaccharide structural studies always tend to focus on repeating units, rather than chain-length regulation. A study demonstrated that in Escherichia coli O9a, a prototype for the biosynthesis of O-antigens by the ABC transporter dependent pathway, the occurrence of distinct chain-length of O-antigens was dependent on the relative concentration of two enzymes, the glycosyl transferase WbdA and the bifunctional kinase–methyl transferase WbdD [54]. As a methyltransferase UbiG and three glycosyl transferases were also annotated in WL21, we propose that there might be similar chain-length regulating mechanism in Y. enterocolitica. Together, these results still proved that the dcuC-galU-galF locus is the O-AGC of WL21, and that the WL21 O-antigen is synthesized by the ABC transporter dependent pathway.

Figure 2. LPS profiles of WL21 and its derivatives. LPS extracts were electrophoresed on sodium dodecyl sulfate–polyacrylamide gel electrophoresis gels, and stained by silver staining. Lane 1, WL21 wide-type strain; lane 2, WL-21Δwzm; and lane 3, WL-21Δwzm::wzm.

The Putative O-AGCs of Most Y. enterocolitica Are Generally Divided into Two Genetic Patterns

A total of 137 Y. enterocolitica isolates from GenBank were assigned to certain serotypes by the submitters, the majority of which are prevalent serotypes with their O-AGCs being reported before this study: 41 for serotype O:3, eight for serotype O:5, 17 for serotype O:5,27, ten for serotype O:8, and 31 for serotype O:9. The remainder are isolates with uncharacterized O-AGCs, including isolates of serotypes O:1, O:2, O:4, O:6, O:7, O:13, O:19, O:21, and O:36. We next derived the putative O-AGCs from their genomes. Our analysis indicated that (1) isolates with the same serotype possess identical genetic organization within the putative O-AGC; and (2) most serotypes exhibit unique O-AGC profiles with the exception of O:1, O:2, O:7 and O:19.

Consequently, we selected one isolate within each serotype as a type strain for further analysis and found the genetic loci of these O-AGCs exhibited two patterns: within the hemH-gsk locus or somewhere else (Fig. 3). In addition, the O-AGCs shared by O:1 and O:2 were similar to that of O:3, and their O-AGCs were located between or adjacent to insertion sequence (IS), as was also the case in O:5 and O:5,27. Another common feature of the above-mentioned serotypes, along with O:9 and O:10 (strain WL-21 in this study), is that the O-AGCs were all located outside the hemH-gsk locus, and that their O-antigens seem to be synthesized by the ABC transporter dependent pathway. The putative O-AGCs of serotypes O:4, O:7/O:19, O:13, and O:21 were all mapped between hemH and gsk, as was also the case with O:8, and genes in each serotype were transcribed from hemH to gsk. However, in the case of O:36, the putative O-AGC genes were located between hemH and gsk, with the exception of four genes which were upstream of hemH and transcribed in the opposite direction. Another probably shared characteristic of these serotypes was that they produce their O-antigens via the Wzx/Wzy dependent pathway, except in the case of O:7/O:19. In particular, all strains of the latter pattern had a DDH sugar synthesis gene set which was present at the 5’ end within their O-AGCs (Fig. 3). All these features resembled those found in Y. pseudotuberculosis [55]. This evidence implied that the O-AGCs of Y. enterocolitica serotypes with hemH-gsk patterns, and those of Y. pseudotuberculosis, very likely originated from a common ancestor, followed by separate evolutionary events under the pressure of different niches, whereas the O-AGCs with the wzm/wzt gene set underwent a distinct evolutionary history.

Intriguingly, strains of O:7/O:19 possessed wzm/wzt and wzx/wzy simultaneously within their hemH-gsk loci (Fig. 3); this has not been previously reported among the O-AGCs of Y. enterocolitica and other Yersinia species. In a Vibrio cholera strain, the co-location of O-AGC and capsular synthesis genes containing both wzm/wzt and wzx/wzy was revealed, suggesting co-evolution of new O- and capsular-antigens [56]. However, no evidence of capsule has been reported in Y. enterocolitica. Therefore, the elucidation of the O-antigen processing mechanism in O:7/O:19 may arouse more interests in our next study. Another piece of evidence which attracted our attention was that none of the serotype O:6 isolates possessed standard O-AGC; only the outer core gene cluster within the hemH-gsk locus was discovered. In a few species, for example, in Vibrio parahaemolyticus, the O-antigen is deficient in the LPS molecule and the antigenic scheme is based on the variation of core oligosaccharide [57]. Thus, we propose that the antigenic property of O:6 may be determined by its core oligosaccharide, instead of O-antigen. This hypothesis in Y. enterocolitica O:6 could be addressed by fully elucidating the LPS structure.

Strains of Serotypes are Grouped according to Their Virulence Profiles

A total of 138 genomes representing 15 serotypes were investigated for virulence gene screening (Fig. 4). Among these virulence genes, inv, ymoA, yplA, filA, flhC, and filD were distributed in all or almost all isolates; no differences among serotypes were therefore exhibited. According to the pattern of other virulence genes, the 15 serotypes could be clearly divided into three groups: Group 1, consisting of serotypes O:1, O:2, O:3, O:5,27 and O:9; Group 2, mainly composed of serotypes O:5, O:6,30, and a few other minor serotypes including O:10 of this study; and Group 3, with serotype O:8 as its main member, along with O:4, O:21, one strain of O13, and one strain of O7 (Fig. 4).

Figure 4. Virulence profiles of strains with serotypes derived from GenBank data. From left to right: virulence genes, with black indicating presence and white indicating absence; serotype highlighted in different colors; strain name with biotype from meta data if available. ^aPlasmid-borne genes.

In Group 1, the largest group, all isolates were characterized by the presence of ail and ystA, and the absence of myfA, yadA, ystB, fyuA, ybtP, ybtQ, and yas genes. Clearly, isolates of Group 1 could be further divided into two subgroups: 1a and 1b. Except for serotype O:2 strains which were located in Group 1b, other strains assigned to serotypes O:1, O:3, O:5,27 and O:9 were distributed into two subgroups. Obviously, the two subgroups were differentiated only by the presence/absence of the yop virulon. The yop virulon is the core of Yersinia pathogenicity machinery and is located within the Pyv [33]; unfortunately, it may be lost during prolonged storage, frequent passaging, or temperatures higher than 37°C [58], which, we propose, may lead to the absence of yop virulon in Group 1a. myfA, encoding a factor important for the beginning of infection, was originally found in bioserotype 4/O:3 strains isolated from clinical cases of yersiniosis, as well as some biotype 1A strains from patients with diarrhea [59]; however, no myfA was found in the O:3 strains in this study.

Within Group 2, all isolates possessed ystB instead of ystA, and most isolates possess myfA and yadA, the two genes absent in all isolates of Group 1. While ystB, instead of ystA, is known as a classical virulence marker of biotype 1A strain [19], the strong implication of ystB in serotypes O:5 and O:6, the main members of Group 2, has not been recorded previously. Another feature of Group 2 is that none of the isolates held ail or yop virulons. In contrast to the situation in subgroup 1a, the absence of yop virulon in Group 2 was unlikely to be attributed to the loss of PYv, since none of the Group 2 isolates were yop virulon positive. In terms of clinical manifestation, O:5/O:6 strains may partially or wholly lose the ability to cause the formation of necrotic abscesses; this is mainly mediated by the functionality of Pyv [60].

The main characteristics of Group 3 were that fyuA, ybtP, ybtQ, and yas genes were only present in the relevant isolates of this group, and thus the virulence factors were most abundant. fyuA, ybtP and ybtQ are the most representative genes of a pathogenicity island termed the high-pathogenicity island (HPI), and most of the genes of HPI are involved in the biosynthesis, transport, and regulation of yersiniabactin [61]. In addition, yas genes located within a Ysa pathogenicity island (Ysa-PI) encoding another T3SS play an important role in the colonization of gastrointestinal tissues during the earliest stage of infection [62]. HPI and Ysa-PI have been reported to be present only in Y. enterocolitica biotype 1B, the highly virulent biotype [63]. Our genome-wide analysis also showed that these two PIs were only present in isolates of Group 3 (three of these were assigned to biotype 1B), suggesting that strains of Group 3 must have unique pathogenic characteristics and mechanisms.

Herein, the in silico O-AGC characterization of non-prevalent serotypes provides the genetic basis for the design of novel geno-serotyping targets, and for the development of novel assays for subtyping and epidemiological surveillance. The revealing of different patterns of O-AGC locations indicates that there must be distinct evolutionary route among Y. enterocolitica strains, the mechanism of which needs further investigation. The O-antigen is a key virulence determinant, and its role in the pathogenesis of Y. enterocolitica has also been identified [26, 27]. In particular, the relationship between certain serotypes and specific virulence factors has been investigated in several bacteria species, for instance, in enterohemorrhagic E. coli O157:H7 [64]. Moreover, the regulation role of O-antigen in pathogenic promotion and environmental tolerance has also been confirmed [65, 66]. Here, we revealed a strong association between O-serotypes and the profile of virulence genes in Y. enterocolitica as a whole; this finding, we believe, will advance research into the role of O-antigens and other virulence factors, including their synergistic effect in the pathogenicity of this important food-borne pathogen.

This work was supported by the Shandong Provincial Natural Science Foundation General Project (grant number ZR2022MH318), the Tianjin Municipal Natural Science Foundation (grant number 17JCYBJC24300), and the National Key Program for Infectious Diseases of China (grant number 2017ZX10303405).

B.H., J.W., L.L., B.Y.C., Conceptualization; B.H., Investigation; B.H., J.W., Q.W., Y.X.C., J.X.Y., Methodology; J.W., L.L., Q.W., Y.X.C., W.K.S., Formal analysis; J.W., L.L., Writing-Original Draft Preparation; J.L.Q., Software; B.Y.C., X.G., Review& Editing; B.Y.C., X.G., Supervision; B.H., X.G., Funding Acquisition.

The authors have no financial conflicts of interest to declare.