전체메뉴
검색
Article Search

JMB Journal of Microbiolog and Biotechnology

QR Code QR Code

Research article

Molecular and Cellular Microbiology (MCM)  |  Fermentation and Food Technology

Deficiency in Opu Systems Imparts Salt-Sensitivity to Weizmannia coagulans

Tao Kim1,2, Sojeong Heo1, Jong-Hoon Lee3, and Do-Won Jeong1*

1Department of Food and Nutrition, Dongduk Women’s University, Seoul 02748, Republic of Korea
2Pulmuone Institute of Technology, Cheongju 28220, Republic of Korea
3Department of Food Science and Biotechnology, Kyonggi University, Suwon 16227, Republic of Korea

Correspondence to:
Do-Won Jeong,         jeongdw@dongduk.ac.kr
Received: April 9, 2024; Revised: May 14, 2024; Accepted: May 20, 2024

J. Microbiol. Biotechnol. 2024; 34(7): 1443-1451

Published July 28, 2024 https://doi.org/10.4014/jmb.2404.04016

Copyright © The Korean Society for Microbiology and Biotechnology.

Abstract

Weizmannia coagulans can be used as a starter strain in fermented foods or as a probiotic. However, it is salt-sensitive. Here, W. coagulans genomes were compared with the genomes of strains of Bacillus species (B. licheniformis, B. siamensis, B. subtilis, and B. velezensis) that were isolated from fermented foods and show salt tolerance, to identify the basis for the salt-sensitivity of W. coagulans. Osmoprotectant uptake (Opu) systems transport compatible solutes into cells to help them tolerate osmotic stress. B. siamensis, B. subtilis, and B. velezensis each possess five Opu systems (OpuA, OpuB, OpuC, OpuD, and OpuE); B. licheniformis has all except OpuB. However, W. coagulans only has the OpuC system. Based on these findings, the opuA and opuB operons, and the opuD and opuE genes, were amplified from B. velezensis. Expression of each of these systems, respectively, in W. coagulans increased salt-tolerance. W. coagulans expressing B. velezensis opuA, opuD, or opuE grew in 10.5% NaCl (w/v), whereas wild-type W. coagulans could not grow in 3.5% NaCl. The salt resistance of B. subtilis was also increased by overexpression of B. velezensis opuA, opuB, opuD, or opuE. These results indicate that the salt-susceptibility of W. coagulans arises because it is deficient in Opu systems.

Keywords

Weizmannia coagulans, salt tolerance, Bacillus, Opu system, genome

Graphical Abstract


Introduction

Bacillus coagulans was first isolated from spoiled evaporated milk [1] and later reclassified as Weizmannia coagulans based on genomic analysis [2]. W. coagulans is a Gram-positive, lactic acid-producing, facultative anaerobic, spore-forming bacterium. It is able to endure extreme conditions such as high-temperature, food processing, stomach acids, bile, and high salt, in the form of spores. These properties are great advantages for a probiotic strain that must go through the gastrointestinal tract and an industrial strain that must go through food processing steps [3].

W. coagulans has been studied for a long time as a probiotic bacterium for humans [4-6]. It has several health benefits, including prevention of muscle damage during exercise, improvement of gastrointestinal disorders, ease of diarrhea, and prevention of bacterial vaginosis [4-6]. Health benefits of W. coagulans have been demonstrated in human studies [7, 8], and W. coagulans is sold commercially as a probiotic.

W. coagulans is naturally distributed in a variety of niches including soil, water, and air. It is also found in food materials such as soybean, locust bean, maize, rice, and others [3, 9-11]. W. coagulans produces exo-enzymes such as amylase, protease, and lipase. These activities contribute to improvement of the quality and sensory properties of fermented foods via protein and carbohydrate degradation [3, 12, 13]. W. coagulans also produces compounds with activity against Gram-positive and Gram-negative bacteria [14]. Therefore, W. coagulans is used in various commercial food products, including dairy foods, fermented meats, cereals, baby foods, and ice cream [3].

The Qualified Presumption of Safety (QPS) system of the European Union Food Safety Authority was introduced to assess the safety of food and feed microorganisms [15], and W. coagulans has been on the QPS list since 2007. Also, four W. coagulans strains have been given Generally Recognized as Safe status by the US Food and Drug Administration (http://www.fda.gov/) [16]. W. coagulans is also on the Food Materials list of the Ministry of Food and Drug Safety, Korea (Notification of the Ministry of Food and Drug Safety No. 2024-20). These classifications confirm that W. coagulans is nonpathogenic and can be applied in the food industry, including as a probiotic.

Most research on W. coagulans has focused on its functional properties as a probiotic strain, while its use as a starter candidate for fermented foods has been studied less. However, 31 W. coagulans strains from rice straw were assessed for their antibiotic susceptibility using the minimum inhibitory concentration test and their enzymatic (protease and lipase) activities, to select safe starter candidates for sensory improvement of fermented foods [17]. At the same time, it was found that W. coagulans did not grow on tryptic soy agar (TSA) containing 3% NaCl (w/v). The NaCl concentration of most fermented foods is >2%, and for starters to work efficiently in fermented foods, growth must be possible in the salt concentration of the food. Here, we determined the reason for the salt-sensitivity of W. coagulans.

Materials and Methods

Bacterial Strains and Culture Conditions

The strains and plasmids used in this study are listed in Table 1. Escherichia coli was cultured in Luria-Bertani agar (Becton, Dickinson and Co., USA), Bacillus in tryptic soy agar (TSA; Becton, Dickinson and Co.), and W. coagulans in de Man, Rogosa, and Sharpe (Becton, Dickinson and Co.) agar. When necessary, antibiotics were added to the growth medium at the following concentrations: ampicillin, 100 μg/ml; erythromycin, 10 μg/ml; kanamycin, 10 μg/ml.

Table 1 . Bacterial strains and plasmids used in this study.

Strain/plasmidRelevant characteristic(s)Source or reference
Strain
W. coagulans
KCTC 3625TWeizmannia coagulans type strain, wild-type strainKorean Collection for Type
Cultures (KCTC), South Korea
ASRS217Potential starter candidate, isolated from rice straw[17]
B. licheniformis
KCCM 12145TBacillus licheniformis type strainKorean Culture Center of
Microorganisms (KCCM), South Korea
0DA23-1Potential starter candidate, isolated from commercial doenjang[18]
B. siamensis
KCTC 13613TB. siamensis type strainKCTC, South Korea
B28Potential starter candidate, isolated from kimchi[19]
B. subtilis
KCCM 32835TB. subtilis type strainKCCM, South Korea
SRCM102748Isolated from kimchiSRCM, South Korea
ISW1214hsrM1, leuA8, metB5, Tet5Takara Bio, Japan
B. velezensis
KCTC 13012TB. velezensis type strainKCTC, South Korea
DMB07Isolated from fermented soybeanUnpublished results
E. coli
DH5αEscherichia coli, cloning host for recombinant plasmidsStratagene, USA
BL21 (DE3)E. coli recA+ strain, host for protein expressionNEB, USA
Plasmid
pLipSME. coli–Bacillus shuttle vector, cloning vector, Ampr, Kanr[20]
pL-opuApLipSM derivative containing opuA operonThis study
pL-opuBpLipSM derivative containing opuB operonThis study
pL-opurBpLipSM derivative containing yvaV and opuB operonThis study
pL-opuDpLipSM derivative containing opuDThis study
pL-opuEpLipSM derivative containing opuEThis study
pYJ335E. coli–staphylococcal shuttle vector, Ampr, Eryr[21]
pYJ-opuApYJ335 derivative containing opuA operonThis study
pYJ-opuBpYJ335 derivative containing opuB operonThis study
pYJ-opurBpYJ335 derivative containing yvaV and opuB operonThis study
pYJ-opuDpYJ335 derivative containing opuDThis study
pYJ-opuEpYJ335 derivative containing opuEThis study


Comparative Genomic Analyses

For comparative genomic analysis of W. coagulans and four Bacillus species, which were mainly isolated from fermented foods, genome sequence data were obtained from the NCBI (http://ncbi.nlm.nih.gov/genomes)(Table 2). Genes were predicted using the RAST server for SEED-based automated annotation [40]. The predicted genes of the strains were confirmed using CLgenomics ver. 1.55 software (CJ Bioscience, Republic of Korea) and the iPath (ver. 3) module [41].

Table 2 . Genomic features of strains of Weizmannia coagulans and four Bacillus species.

SpeciesStrainSize (bp)G+C content (mol%)OriginCountryAccession no.Reference
W. coagulansKCTC 3625T3,366,99546.90Dairy (evaporated milk)USANZ_CP009709[22]
ASRS2173,514,33046.47Rice strawSouth KoreaNZ_CP058594[23]
HM-083,624,64146.30Healthy chicken intestineChinaNZ_CP010525[24]
IDCC12013,664,21546.20Green maltSouth KoreaNZ_CP035305[9]
DSM 23143,628,65146.24RhizosphereunknownNZ_CP033687[25]
B. licheniformisKCCM 12145T4,222,59746.20UnknownunknownNZ_CP034569[26]
0DA23-14,405,37346.00DoenjangSouth KoreaNZ_CP031126[27]
14ADL44,332,23245.90DoenjangSouth KoreaNZ_CP026673[18]
MCC 25144,230,48046.20Raw milk (sheep)IndiaNZ_CP038186[28]
TCCC 111484,341,07645.90SoilunknownNZ_CP033218[29]
B. siamensisKCTC 13613T3,779,69646.30Salted crabSouth KoreaAJVF01000000-51[30]
B283,946,17845.89KimchiSouth KoreaNZ_CP066219-21[19]
SCSIO 057464,268,31645.98Sea mudIndian OceanNZ_CP025001[31]
B. subtilisKCCM 32835T4,215,60743.34Soil under a mango treeunknownNZ_CP020102-3[32]
SRCM1027484,210,79743.60KimchiSouth KoreaNZ_CP028212[33]
PS8324,215,36743.50SoilunknownNZ_CP010053[34]
HRBS-10TDI134,186,26943.29Soybean pasteSouth KoreaNZ_CP015222-
GFR-124,202,95543.30Chung-gook-jangSouth KoreaNZ_CP032852[35]
B. velezensisKCTC 13012T4,034,33546.30River VelezSpainNZ_LLZC01000001-24[36]
DMB053,262,56346.25MejuSouth KoreaNZ_CP083715-7[37]
DMB064,157,94546.20DoenjangSouth KoreaNZ_CP083763[38]
DMB074,157,94545.60MejuSouth KoreaNZ_CP083764-
KMU013,932,43746.50KimchiSouth KoreaNZ_CP063768[39]

- mean that there are no papers published

DNA Cloning and Transformation

Plasmids and genomic DNA of E. coli, B. subtilis, and W. coagulans were extracted with an Inclone Plasmid Mini Prep Kit (Inclone Biotech, Republic of Korea) and a DNeasy Tissue Kit (Qiagen, Germany), respectively, according to the manufacturers’ instructions. B. subtilis and W. coagulans were treated with lysozyme (0.1 g/ml) at 37°C for 1h before DNA extraction.

Genes related to the Opu system from B. velezensis DMB07 were amplified by PCR using primer sets containing the appropriate restriction enzyme sites for insertion into pLipSM or pYJ335 (Table 3). PCR amplifications were performed using a T3000 thermocycler (Biometra, Germany) [42] and an Inclone Taq Polymerase Kit (Inclone Biotech) according to the manual. PCR primers were designed based on Opu system genes and nearby sequences of B. velezensis strain DMB07 (Table 3). All PCRs were performed using 30 cycles of denaturing at 95°C for 1 min, annealing at 63°C for 1.5 min, and elongation at 72°C for 1.5 min. Amplicons were digested by appropriate enzymes and inserted into same sites of pLipSM or pYJ335. Constructed plasmids were verified by PCR using pLipSM-check-F primer or pYJ335-check-F primer and DNA sequencing. Constructed plasmids derived from pYJ335 were introduced into E. coli DH5α (Stratagene, USA) by the method of Hanahan and Meselson [43], and then into W. coagulans KCTC 3625T (KCTC; Korean Collection for Type Cultures, South Korea) by electroporation [44] with a gene pulser (Bio-Rad, USA). For introduction into B. subtilis ISW1214 of pLipSM-derived plasmids, DNA extracted from E. coli BL21 (DE3) (New England Biolabs, USA) was used [20].

Table 3 . Oligonucleotides used in this study.

OligonucleotideSequence (5 → 3)aUseAmplified size (bp)
plipSM vector
opuAA-BamHI-F’CGGGATCCGCCTGATAAAAGCCCGGTTTCCopuAA upstream3,367
opuAC-SmaI-R’TCCCCCGGGGGATGAACCTCTTGTGACAACCopuAC downstream
opuBA-BamHI-F’CGCGTCGACGCTCATTTGATTACCCCTCTGCopuBA upstream3,747
opuBD-SalI-R’CGGGATCCCCGGTCAATACGGGTAAATCopuBD downstream
yvaV-BamHI-F’CGGGATCCGAAAAAACGAACCAAAGCGCCGyvaV downstream4,405
opuD-BamHI-F’CGGGATCCCGTCCCCGTTGATAATTGACCopuD upstream1,787
opuD-SalI-R’ACGCGTCGACCCTGTGATCCTGAAGGTGAGCopuD downstream
opuE-EcoRI-F’CGCAATTCGGTTTAGTAACCATAGCCGGCopuE upstream1,746
opuE-BamHI-R’CGGGATCCGCTCAATTTGCACAGCACCTCCopuE downstream
plipSM-check-F’CCAGCCGAAAGAAGCCAAAGCHpa II promoter downstream, upstream of insertion site
pYJ335 vector
opuAA-KpnI-F’CCGGTACCGCCTGATAAAAGCCCGGTTTCCopuAA upstream3,367
opuAC-KpnI-R’CCGGTACCGGATGAACCTCTTGTGACAACCopuAA downstream
opuBA-KpnI-F’CCGGTACCGCTCATTTGATTACCCCTCTGCopuBA upstream3,747
opuBD-KpnI-R’CCGGTACCCCGGTCAATACGGGTAAATCopuBD downstream
yvaV-KpnI-F’CCGGTACCGAAAAAACGAACCAAAGCGCCGyvaV downstream4,405
opuD-KpnI-F’CCGGTACCCGTCCCCGTTGATAATTGACCopuD upstream1,787
opuD-KpnI-R’CCGGTACCCCTGTGATCCTGAAGGTGAGCopuD downstream
opuE-KpnI-F’CCGGTACCGGTTTAGTAACCATAGCCGGCopuE upstream1,746
opuE-KpnI-R’CCGGTACCGCTCAATTTGCACAGCACCTCCopuE downstream
pYJ335-check-F’GCGATTAAGTTGGGTAACGCKpnI site upstream of pYJ335

aRestriction sites are underline.

Determination of Salt Tolerance

Salt tolerance of the strains in this study was determined by examining growth on TSA supplemented with up to 14% NaCl (w/v, final concentration). Growth on 0.5% (the NaCl concentration in normal TSA), 3.5%, 7%, 10.5%, and 14% NaCl was determined after incubation for 1, 2, 3, 4, and 5 days. The experiment was performed three times, independently.

Results and Discussion

Growth of W. coagulans on TSA

W. coagulans originally belonged to the genus Bacillus but was later reclassified. Most Bacillus species can grow on medium supplemented with >7% NaCl (w/v, final concentration) [45-47]. In contrast, W. coagulans does not grow at a salt concentration of >3% [17]. To reconfirm this, the growth of W. coagulans was checked in different salt conditions. As shown in Fig. 1, W. coagulans grew well on TSA without added extra salt (TSA contains 0.5%NaCl), while it did not grow on TSA with final NaCl concentrations of 3.5% or 7%. In contrast, B. licheniformis, B. siamensis, B. subtilis, and B. velezensis grew on TSA with a final NaCl concentration of 7% (Fig. 1).

Fig. 1. Effect of NaCl on growth of Weizmannia coagulans and four Bacillus species. Tryptic soy agar (TSA) containing 0%–7% (w/v) NaCl was used for the detection of growth. Strains: W1, W. coagulans KCTC 3625T; W2, W. coagulans ASRS217; L1, B. licheniformis KCCM 12145T; L2, B. licheniformis 0DA23-1; Si1, B. siamensis KCTC 13613T; Si2, B. siamensis B28; Su1, B. subtilis KCCM 32835T; Su2, B. subtilis SRCM102748; V1, B. velezensis KCTC 13012T; V2, B. velezensis DMB07.

Comparative Genomic Analysis of Salt Tolerance

B. licheniformis, B. siamensis, B. subtilis, and B. velezensis are predominantly isolated from fermented soybean products such as meju and doenjang [45, 48]. The enzymatic activities of these species contribute to the development of sensory properties of the fermented foods. Therefore, several studies have reported analysis of these strains for use as starters [38, 49, 50]. W. coagulans is also isolated from several foods and exhibits protease and lipase activities, so it was judged that it could improve the sensory properties of fermented foods. However, W. coagulans is sensitive to salt compared with the four Bacillus species. Therefore, we undertook comparative genomic analysis of these species, looking for factors that affect their salt tolerance (Table 2).

To resist osmotic stress, many bacteria accumulate compatible solutes such as choline, glycine betaine, and proline betaine through uptake from outside the cell via transporters including osmoprotectant uptake (Opu) transporter [51, 52]. The Opu system is known to be involved in salt resistance [51]. W. coagulans genomes possess the OpuC system. Meanwhile, B. licheniformis encodes four Opu systems, and B. siamensis, B. subtilis, and B. velezensis possess five Opu systems (Fig. 2). OpuA, OpuB, and OpuC belong to the ATP-binding cassette transporter superfamily, and OpuD and OpuE are single-component transporters belonging to the BCCT (Betaine/Carnitine/Choline Transporters) family [51]. In the current study, the encoded OpuA, OpuB, and OpuC systems were found to contain the common substrate-binding, transporter, and ATP-binding proteins. Although Hoffmann and Berner reported that Bacillus species contain five Opu systems [51], B. licheniformis genomes lack the OpuB system. Our results suggest that the low salt-tolerance of W. coagulans compared with high salt-tolerance of Bacillus species is due to it only having one Opu system.

Fig. 2. Predicted mechanism of salt-sensitivity of W. coagulans based comparative genomic analysis with four Bacillus species. Compatible solutes are depicted in black text in yellow boxes. Color coding indicates which species contain which opu genes.

Opu Systems Enhance the Salt Tolerance of B. subtilis

As a result of the comparative genome analysis, the salt-sensitivity of W. coagulans was reasoned to arise from a deficiency in Opu systems. To test that, we aimed to introduce “absent” genes into W. coagulans to determine the effect on salt resistance. Plasmid pLipSM is an E. coli/Bacillus shuttle vector [20]. Although W. coagulans has been reclassified from genus Bacillus, this plasmid is also functional in Weizmannia. opu genes from B. velezensis DMB07 (which contains all the opu genes and had the highest salt resistance among the strains we tested) were cloned and introduced into W. coagulans via this plasmid. Note that we did not clone opuC from B. velezensis DMB07 because W. coagulans naturally possesses this system (see section 2.2). The obtained recombinant plasmids were designated pL-opuA, pL-opuB, pL-opuD, and pL-opuE, respectively. In addition, pL-opurB was reconstructed with the opuB operon and the yvaV gene, which is a regulator for expression of the opuB operon (Fig. 3A).

Fig. 3. Construction of pLip-SM-derived plasmids containing opu genes from B. velezensis DMB07 (A) and salt-tolerance of B. subtilis containing these plasmids (B). TSA containing up to 14% NaCl (w/v, final concentration) was used for the detection of growth.

Because W. coagulans strain KCTC 3625T is a wild-type, it was not expected to be easy to introduce recombinant plasmids into the strain, so they were first introduced into laboratory strain B. subtilis ISW1214. We tested whether the protein expression vectors had an effect on the salt resistance of transformed B. subtilis ISW1214. As shown in Fig. 3B, wild-type B. subtilis ISW1214 grew in medium containing 7% NaCl, but not in medium containing 10.5% or 14% NaCl. However, when any one of the B. velezensis Opu systems was overexpressed, the resulting strain grew on 14% NaCl. The multicomponent systems OpuA and OpuB enabled better growth on 14%NaCl than the single-component systems OpuD and OpuE (Fig. 3B).

Opu Systems Confer Salt Tolerance to W. coagulans

pLipSM-based plasmids produced in B. subtilis were purified and introduced into W. coagulans KCTC 3625T, but W. coagulans KCTC 3625T showed resistance to low concentrations of kanamycin, which is the selection marker in pLipSM, so it was not easy to select W. coagulans transformants containing pLipSM-derived plasmids. Accordingly, we tried to introduce opu genes into W. coagulans KCTC 3625T by using pYJ335, which has the erythromycin resistance gene as a selection marker. The replicon of plasmid pYJ335 was derived from pUC19 and pE194 fragments [21]. The replicon can be cloned from lactic acid bacteria and Staphylococcus [53]. The opu genes were amplified from B. velezensis DMB07 in the same way as in the previous experiment (see section 3.3), and recombinant plasmids were generated by inserting the opuA and opuB operons, and opuD and opuE genes, to produce pYJ-opuA, pYJ-opuB, pYJ-opuD, and pYJ-opuE (Fig. 4A). The vector containing the opuB operon, including the yvaV gene, which is a regulator for expression of the opuB operon, was named pYJ-opurB. These vectors were each transformed directly into W. coagulans (without going through B. subtilis). All the transformed strains grew in medium with 7% NaCl added, and all except the OpuB-containing transformants grew in 10.5%salt (Fig. 4B).

Fig. 4. Construction of pYJ335-derived plasmids containing opu genes from B. velezensis DMB07 (A) and salt-tolerance of W. coagulans containing these plasmids (B). de Man, Rogosa, and Sharpe medium containing up to 10.5% NaCl (w/v, final concentration) was used for the detection of growth.

In previous studies, 67.7% and 71.0% of W. coagulans strains showed protease and lipase activities, respectively; these activities produce amino acids and fragrance components from lipids, respectively [17]. In addition, it can be predicted that all the strains of W. coagulans have production performance in the condition containing NaCl, and that most strains can inhibit the growth of other microorganisms via antibacterial activity [17] However, the W. coagulans strains were sensitive to salt. Most fermented foods contain a significant salt content. Therefore, even though W. coagulans is widely distributed in the environment [3, 9-11, 54, 55] and in the raw materials used to prepare fermented foods, detection of this species is lowered in foods with added salt [17]. If W. coagulans were to be salt-resistant, it would be expected to play a greater role in fermented food production. Here, the genetic basis of the sensitivity of W. coagulans to salt, i.e. a deficiency in Opu systems, was determined. These results will help with screening for salt-resistant strains.

Acknowledgments

This work was supported by the National Research Foundation of Korea (NRF) [NRF-2022M3A9I3082364].

Conflict of Interest

The authors have no financial conflicts of interest to declare.

References

  1. Hammer BW. 1915. Bacteriological studies on the coagulation of evaporated milk (Vol. 17). Agricultural Experiment Station, Iowa State College of Agriculture and Mechanic Arts.
  2. Gupta RS, Patel S, Saini N, Chen S. 2020. Robust demarcation of 17 distinct Bacillus species clades, proposed as novel Bacillaceae genera, by phylogenomics and comparative genomic analyses: description of Robertmurraya kyonggiensis sp. nov. and proposal for an emended genus Bacillus limiting it only to the members of the Subtilis and Cereus clades of species. Int. J. Syst. Evol. Microbiol. 70: 5753-5798.
    Pubmed CrossRef
  3. Konuray G, Erginkaya Z. 2018. Potential use of Bacillus coagulans in the food industry. Foods 7: 92.
    Pubmed PMC CrossRef
  4. Jäger R, Shields KA, Lowery RP, De Souza EO, Partl JM, Hollmer C, et al. 2016. Probiotic Bacillus coagulans GBI-30, 6086 reduces exercise-induced muscle damage and increases recovery. Peer J. 4: e2276.
    Pubmed PMC CrossRef
  5. Majeed M, Majeed S, Nagabhushanam K, Natarajan S, Sivakumar A, Ali F. 2016. Evaluation of the stability of Bacillus coagulans MTCC 5856 during processing and storage of functional foods. Int. J. Food Sci. Technol. 51: 894-901.
    CrossRef
  6. Ratna Sudha, M Yelikar KA, Deshpande S. 2012. Clinical study of Bacillus coagulans unique IS-2 (ATCC PTA-11748) in the treatment of patients with bacterial vaginosis. Indian J. Microbiol. 52: 396-399.
    Pubmed PMC CrossRef
  7. Elshaghabee FMF, Rokana N, Gulhane RD, Sharma C, Panwar H. 2017. Bacillus as potential probiotics: status, concerns, and future perspectives. Front. Microbiol. 8: 1490.
    Pubmed PMC CrossRef
  8. Maity C, Gupta AK, Saroj DB, Biyani A, Bagkar P, Kulkarni J, et al. 2021. Impact of a gastrointestinal stable probiotic supplement Bacillus coagulans LBSC on human gut microbiome modulation. J. Diet. Suppl. 18: 577-596.
    Pubmed CrossRef
  9. Bang WY, Ban OH, Lee BS, Oh S, Park C, Park MK, et al. 2021. Genomic-, phenotypic-, and toxicity-based safety assessment and probiotic potency of Bacillus coagulans IDCC 1201 isolated from green malt. J. Ind. Microbiol. Biotechnol. 48: kuab026.
    Pubmed PMC CrossRef
  10. Lee B, Lee H, Jeong DW, Lee JH. 2015. A rapid isolation method for Bacillus coagulans from rice straw. Microbiol. Biotechnol. Lett. 43: 401-404.
    CrossRef
  11. Shudong P, Guo C, Wu S, Cui H, Suo H, Duan Z. 2022. Bioactivity and metabolomics changes of plant-based drink fermented by Bacillus coagulans VHProbi C08. LWT - Food Sci. Technol. 153: 113030.
    CrossRef
  12. Babu KR, Satyanarayana T. 1995. α-Amylase production by thermophilic Bacillus coagulans in solid state fermentation. Process Biochem. 30: 305-309.
    CrossRef
  13. Olajuyigbe FM, Ehiosun KI. 2013. Production of thermostable and organic solvent-tolerant alkaline protease from Bacillus coagulans PSB-07 under different submerged fermentation conditions. Afr. J. Biotechnol. 12: 3341-3350.
  14. Le Marrec C, Hyronimus B, Bressollier P, Verneuil B, Urdaci MC. 2000. Biochemical and genetic characterization of coagulin, a new antilisterial bacteriocin in the pediocin family of bacteriocins, produced by Bacillus coagulans I4. Appl. Environ. Microbiol. 66: 5213-5220.
    Pubmed PMC CrossRef
  15. EFSA. 2007. Introduction of a qualified presumption of safety (QPS) approach for assessment of selected microorganisms referred to EFSA. EFSA J. 587: 1-16.
    CrossRef
  16. Heo S, Kim T, Na HE, Lee G, Park JH, Park HJ, et al. Safety assessment systems for microbial starters derived from fermented foods. J. Microbiol. Biotechnol. 32: 1227-1233.
    Pubmed PMC CrossRef
  17. Kim YS, Lee J, Heo S, Lee JH, Jeong DW. 2021. Technology and safety evaluation of Bacillus coagulans exhibiting antimicrobial activity for starter development. LWT - Food Sci. Technol. 137: 110464.
    CrossRef
  18. Jeong DW, Lee B, Lee J H. 2018. Complete genome sequence of Bacillus licheniformis 14ADL4 exhibiting resistance to clindamycin. Korean J. Microbiol. 54: 169-170.
  19. Heo S, Kim JH, Kwak MS, Jeong DW, Sung MH. 2021. Functional genomic insights into probiotic Bacillus siamensis strain B28 from traditional Korean fermented kimchi. Foods 10: 1906.
    Pubmed PMC CrossRef
  20. Lee MH, Song JJ, Choi YH, Hong SP, Rha E, Kim HK, et al. 2003. High-level expression and secretion of Bacillus pumilus lipase B26 in Bacillus subtilis Chungkookjang. J. Microbiol. Biotechnol. 13: 892-896.
  21. Ji Y, Marra A, Rosenberg M, Woodnutt G. 1999. Regulated antisense RNA eliminates alpha-toxin virulence in Staphylococcus aureus infection. J. Bacteriol. 181: 6585-6590.
    Pubmed PMC CrossRef
  22. Johnson SL, Bishop-Lilly KA, Ladner JT, Daligault HE, Davenport KW, Jaissle J, et al. 2015. Complete genome sequences for 59 Burkholderia isolates, both pathogenic and near neighbor. Genome Announc. 3: e00159-15.
    Pubmed PMC CrossRef
  23. Lee J, Heo S, Kim Y S, Lee JH, Jeong DW. 2020. Complete genome sequence of Bacillus coagulans strain ASRS217, a potential food fermentation starter culture. Korean J. Microbiol. 56: 321-323.
  24. Yao G, Gao P, Zhang W. 2016. Complete genome sequence of probiotic Bacillus coagulans HM-08: a potential lactic acid producer. J. Biotechnol. 228: 71-72.
    Pubmed CrossRef
  25. Maas RH, Bakker RR, Jansen ML, Visser D, Jong E, Eggink G, et al. 2008. Lactic acid production from lime-treated wheat straw by Bacillus coagulans: neutralization of acid by fed-batch addition of alkaline substrate. Appl. Microbiol. Biotechnol. 78: 751-758.
    Pubmed PMC CrossRef
  26. Rey MW, Ramaiya P, Nelson BA, Brody-Karpin SD, Zaretsky EJ, Tang M, et al. 2004. Complete genome sequence of the industrial bacterium Bacillus licheniformis and comparisons with closely related Bacillus species. Genome Biol. 5: R77.
    Pubmed PMC CrossRef
  27. Jeong DW, Lee B, Heo S, Jang M, Lee JH. 2018. Complete genome sequence of Bacillus licheniformis strain 0DA23-1, a potential starter culture candidate for soybean fermentation. Korean J. Microbiol. 54: 453-455.
  28. Rohith HS, Halami PM. 2021. The combined effect of potential probiotic Bacillus licheniformis MCC 2514 and Bifidobacterium breve NCIM 5671 towards anti-inflammatory activity on HT-29 cell lines. Probiotics Antimicrob. Proteins 15: 351-362.
    Pubmed CrossRef
  29. Yuan F, Li K, Zhou C, Zhou H, Liu H, Chai H, et al. 2020. Identification of two novel highly inducible promoters from Bacillus licheniformis by screening transcriptomic data. Genom 112: 1866-1871.
    Pubmed CrossRef
  30. Jeong H, Jeong DE, Kim SH, Song GC, Park SY, Ryu CM, et al. 2012. Draft genome sequence of the plant growth-promoting bacterium Bacillus siamensis KCTC 13613T. J. Bacteriol. 194: 4148-4149.
    Pubmed PMC CrossRef
  31. Pan H, Tian X, Shao M, Xie Y, Huang H, Hu J, et al. 2019. Genome mining and metabolic profiling illuminate the chemistry driving diverse biological activities of Bacillus siamensis SCSIO 05746. Appl. Microbiol. Biotechnol. 103: 4153-4165.
    Pubmed CrossRef
  32. Nye TM, Schroeder JW, Kearns DB, Simmons LA. 2017. Complete genome sequence of undomesticated Bacillus subtilis strain NCIB 3610. Genome Announc. 5: e00364-17.
    Pubmed PMC CrossRef
  33. Iqbal S, Ullah N, Janjua HA. 2021. In vitro evaluation and genome mining of Bacillus subtilis strain RS10 reveals its biocontrol and plant growth-promoting potential. Agriculture 11: 1273.
    CrossRef
  34. Grela A, Jamrozek I, Hubisz M, Iwanicki A, Hinc K, Kazmierkiewicz R, et al. 2018. Positions 299 and 302 of the GerAA subunit are important for function of the GerA spore germination receptor in Bacillus subtilis. PLoS One 13: e0198561.
    Pubmed PMC CrossRef
  35. Heo J, Kim JS, Hong SB, Park BY, Kim SJ, Kwon SW. 2019. Genetic marker gene, recQ, differentiating Bacillus subtilis and the closely related Bacillus species. FEMS Microbiol. Lett. 366: fnz172.
    Pubmed CrossRef
  36. Dunlap CA, Kim SJ, Kwon SW, Rooney AP. 2016. Bacillus velezensis is not a later heterotypic synonym of Bacillus amyloliquefaciens; Bacillus methylotrophicus, Bacillus amyloliquefaciens subsp. plantarum and 'Bacillus oryzicola' are laterheterotypic synonyms of Bacillus velezensis based on phylogenomics. Int. J. Syst. Evol. Microbiol. 66: 1212-1217.
    Pubmed CrossRef
  37. Na HE, Heo S, Kim T, Lee G, Lee JH, Jeong DW. 2023. ComQXPA quorum-sensing systems contribute to enhancing the protease activity of Bacillus velezensis DMB05 from fermented soybeans. Int. J. Food Microbiol. 401: 110294.
    Pubmed CrossRef
  38. Na HE, Heo S, Kim YS, Kim T, Lee G, Lee JH, et al. 2022. The safety and technological properties of Bacillus velezensis DMB06 used as a starter candidate were evaluated by genome analysis. LWT - Food Sci. Technol. 161: 113398.
    CrossRef
  39. Heo S, Kim JH, Kwak MS, Sung MH, Jeong DW. 2021. Functional annotation genome unravels potential probiotic Bacillus velezensis strain KMU01 from traditional Korean fermented kimchi. Foods 10: 563.
    Pubmed PMC CrossRef
  40. Aziz RK, Bartels D, Best AA, DeJongh M, Disz T, Edwards RA, et al. 2008. The RAST Server: rapid annotations using subsystems technology. BMC Genom. 9: 75.
    Pubmed PMC CrossRef
  41. Darzi Y, Letunic I, Bork P, Yamada T. 2018. iPath3.0: interactive pathways explorer v3. Nucleic Acids Res. 46: W510-W513.
    Pubmed PMC CrossRef
  42. Abbas BA, Khudor MH, Saeed BMS. 2014. Detection of hbl, nhe and bceT toxin genes in Bacillus cereus isolates by multiplex PCR. Int. J. Curr. Microbiol. Appl. Sci. 3: 1009-1016.
  43. Hanahan D, Meselson M. 1983. Plasmid screening at high colony density. Methods Enzymol. 100: 333-342.
    Pubmed CrossRef
  44. Kraemer GR, Iandolo JJ. 1990. High-frequency transformation of Staphylococcus aureus by electroporation. Curr. Microbiol. 21: 373-376.
    CrossRef
  45. Jeong DW, Kim HR, Jung G, Han S, Kim CT, Lee JH. 2014. Bacterial community migration in the ripening of doenjang, a traditional Korean fermented soybean food. J. Microbiol. Biotechnol. 24: 648-660.
    Pubmed CrossRef
  46. Jeong DW, Jeong M, Lee JH. 2017. Antibiotic susceptibilities and characteristics of Bacillus licheniformis isolates from traditional Korean fermented soybean foods. LWT - Food Sci. Technol. 75: 565-568.
    CrossRef
  47. Kim T, Heo S, Na HE, Lee G, Kim JH, Kwak MS, et al. 2022. Bacterial community of galchi-baechu kimchi based on culturedependent and -independent investigation and selection of starter candidates. J. Microbiol. Biotechnol. 32: 341-347.
    Pubmed PMC CrossRef
  48. Kim YS, Kim MC, Kwon SW, Kim SJ, Park IC, Ka JO, et al. 2011. Analyses of bacterial communities in meju, a Korean traditional fermented soybean bricks, by cultivation-based and pyrosequencing methods. J. Microbiol. Biotechnol. 49: 340-348.
    Pubmed CrossRef
  49. Jeon HH, Jung JY, Chun BH, Kim MD, Baek SY, Moon JY, et al. 2016. Screening and characterization of potential Bacillus starter cultures for fermenting low-salt soybean paste (Doenjang). J. Microbiol. Biotechnol. 26: 666-674.
    Pubmed CrossRef
  50. Lee MY, Park SY, Jung KO, Park KY, Kim SD. 2005. Quality and functional characteristics of chungkukjang prepared with various Bacillus sp. isolated from traditional chungkukjang. J. Food Sci. 70: M191-M196.
    CrossRef
  51. Hoffmann T, Bremer E. 2017. Guardians in a stressful world: the Opu family of compatible solute transporters from Bacillus subtilis. Biol. Chem. 398: 193-214.
    Pubmed CrossRef
  52. Heo S, Lee J, Lee JH, Jeong DW. 2019. Genomic insight into the salt tolerance of Enterococcus faecium, Enterococcus faecalis and Tetragenococcus halophilus. J. Microbiol. Biotechnol. 29: 151-1602.
    Pubmed CrossRef
  53. Peterbauer C, Maischberger T, Haltrich D. 2011. Food-grade gene expression in lactic acid bacteria. Biotechnol. J. 6: 1147-1161.
    Pubmed CrossRef
  54. Wang L, Xue Z, Zhao B, Yu B, Xu P, Ma Y. 2013. Jerusalem artichoke powder: a useful material in producing high-optical-purity Llactate using an efficient sugar-utilizing thermophilic Bacillus coagulans strain. Bioresour. Technol. 130: 174-180.
    Pubmed CrossRef
  55. Xing SC, Chen JY, Lv N, Mi JD, Chen WL, Liang JB, et al. 2018. Biosorption of lead (Pb2+) by the vegetative and decay cells and spores of Bacillus coagulans R11 isolated from lead mine soil. Chemosphere 211: 804-816.
    Pubmed CrossRef

Related articles in JMB

More Related Articles

Article

Research article

J. Microbiol. Biotechnol. 2024; 34(7): 1443-1451

Published online July 28, 2024 https://doi.org/10.4014/jmb.2404.04016

Copyright © The Korean Society for Microbiology and Biotechnology.

Deficiency in Opu Systems Imparts Salt-Sensitivity to Weizmannia coagulans

Tao Kim1,2, Sojeong Heo1, Jong-Hoon Lee3, and Do-Won Jeong1*

1Department of Food and Nutrition, Dongduk Women’s University, Seoul 02748, Republic of Korea
2Pulmuone Institute of Technology, Cheongju 28220, Republic of Korea
3Department of Food Science and Biotechnology, Kyonggi University, Suwon 16227, Republic of Korea

Correspondence to:Do-Won Jeong,         jeongdw@dongduk.ac.kr

Received: April 9, 2024; Revised: May 14, 2024; Accepted: May 20, 2024

Abstract

Weizmannia coagulans can be used as a starter strain in fermented foods or as a probiotic. However, it is salt-sensitive. Here, W. coagulans genomes were compared with the genomes of strains of Bacillus species (B. licheniformis, B. siamensis, B. subtilis, and B. velezensis) that were isolated from fermented foods and show salt tolerance, to identify the basis for the salt-sensitivity of W. coagulans. Osmoprotectant uptake (Opu) systems transport compatible solutes into cells to help them tolerate osmotic stress. B. siamensis, B. subtilis, and B. velezensis each possess five Opu systems (OpuA, OpuB, OpuC, OpuD, and OpuE); B. licheniformis has all except OpuB. However, W. coagulans only has the OpuC system. Based on these findings, the opuA and opuB operons, and the opuD and opuE genes, were amplified from B. velezensis. Expression of each of these systems, respectively, in W. coagulans increased salt-tolerance. W. coagulans expressing B. velezensis opuA, opuD, or opuE grew in 10.5% NaCl (w/v), whereas wild-type W. coagulans could not grow in 3.5% NaCl. The salt resistance of B. subtilis was also increased by overexpression of B. velezensis opuA, opuB, opuD, or opuE. These results indicate that the salt-susceptibility of W. coagulans arises because it is deficient in Opu systems.

Keywords: Weizmannia coagulans, salt tolerance, Bacillus, Opu system, genome

Introduction

Bacillus coagulans was first isolated from spoiled evaporated milk [1] and later reclassified as Weizmannia coagulans based on genomic analysis [2]. W. coagulans is a Gram-positive, lactic acid-producing, facultative anaerobic, spore-forming bacterium. It is able to endure extreme conditions such as high-temperature, food processing, stomach acids, bile, and high salt, in the form of spores. These properties are great advantages for a probiotic strain that must go through the gastrointestinal tract and an industrial strain that must go through food processing steps [3].

W. coagulans has been studied for a long time as a probiotic bacterium for humans [4-6]. It has several health benefits, including prevention of muscle damage during exercise, improvement of gastrointestinal disorders, ease of diarrhea, and prevention of bacterial vaginosis [4-6]. Health benefits of W. coagulans have been demonstrated in human studies [7, 8], and W. coagulans is sold commercially as a probiotic.

W. coagulans is naturally distributed in a variety of niches including soil, water, and air. It is also found in food materials such as soybean, locust bean, maize, rice, and others [3, 9-11]. W. coagulans produces exo-enzymes such as amylase, protease, and lipase. These activities contribute to improvement of the quality and sensory properties of fermented foods via protein and carbohydrate degradation [3, 12, 13]. W. coagulans also produces compounds with activity against Gram-positive and Gram-negative bacteria [14]. Therefore, W. coagulans is used in various commercial food products, including dairy foods, fermented meats, cereals, baby foods, and ice cream [3].

The Qualified Presumption of Safety (QPS) system of the European Union Food Safety Authority was introduced to assess the safety of food and feed microorganisms [15], and W. coagulans has been on the QPS list since 2007. Also, four W. coagulans strains have been given Generally Recognized as Safe status by the US Food and Drug Administration (http://www.fda.gov/) [16]. W. coagulans is also on the Food Materials list of the Ministry of Food and Drug Safety, Korea (Notification of the Ministry of Food and Drug Safety No. 2024-20). These classifications confirm that W. coagulans is nonpathogenic and can be applied in the food industry, including as a probiotic.

Most research on W. coagulans has focused on its functional properties as a probiotic strain, while its use as a starter candidate for fermented foods has been studied less. However, 31 W. coagulans strains from rice straw were assessed for their antibiotic susceptibility using the minimum inhibitory concentration test and their enzymatic (protease and lipase) activities, to select safe starter candidates for sensory improvement of fermented foods [17]. At the same time, it was found that W. coagulans did not grow on tryptic soy agar (TSA) containing 3% NaCl (w/v). The NaCl concentration of most fermented foods is >2%, and for starters to work efficiently in fermented foods, growth must be possible in the salt concentration of the food. Here, we determined the reason for the salt-sensitivity of W. coagulans.

Materials and Methods

Bacterial Strains and Culture Conditions

The strains and plasmids used in this study are listed in Table 1. Escherichia coli was cultured in Luria-Bertani agar (Becton, Dickinson and Co., USA), Bacillus in tryptic soy agar (TSA; Becton, Dickinson and Co.), and W. coagulans in de Man, Rogosa, and Sharpe (Becton, Dickinson and Co.) agar. When necessary, antibiotics were added to the growth medium at the following concentrations: ampicillin, 100 μg/ml; erythromycin, 10 μg/ml; kanamycin, 10 μg/ml.

Table 1 . Bacterial strains and plasmids used in this study..

Strain/plasmidRelevant characteristic(s)Source or reference
Strain
W. coagulans
KCTC 3625TWeizmannia coagulans type strain, wild-type strainKorean Collection for Type
Cultures (KCTC), South Korea
ASRS217Potential starter candidate, isolated from rice straw[17]
B. licheniformis
KCCM 12145TBacillus licheniformis type strainKorean Culture Center of
Microorganisms (KCCM), South Korea
0DA23-1Potential starter candidate, isolated from commercial doenjang[18]
B. siamensis
KCTC 13613TB. siamensis type strainKCTC, South Korea
B28Potential starter candidate, isolated from kimchi[19]
B. subtilis
KCCM 32835TB. subtilis type strainKCCM, South Korea
SRCM102748Isolated from kimchiSRCM, South Korea
ISW1214hsrM1, leuA8, metB5, Tet5Takara Bio, Japan
B. velezensis
KCTC 13012TB. velezensis type strainKCTC, South Korea
DMB07Isolated from fermented soybeanUnpublished results
E. coli
DH5αEscherichia coli, cloning host for recombinant plasmidsStratagene, USA
BL21 (DE3)E. coli recA+ strain, host for protein expressionNEB, USA
Plasmid
pLipSME. coli–Bacillus shuttle vector, cloning vector, Ampr, Kanr[20]
pL-opuApLipSM derivative containing opuA operonThis study
pL-opuBpLipSM derivative containing opuB operonThis study
pL-opurBpLipSM derivative containing yvaV and opuB operonThis study
pL-opuDpLipSM derivative containing opuDThis study
pL-opuEpLipSM derivative containing opuEThis study
pYJ335E. coli–staphylococcal shuttle vector, Ampr, Eryr[21]
pYJ-opuApYJ335 derivative containing opuA operonThis study
pYJ-opuBpYJ335 derivative containing opuB operonThis study
pYJ-opurBpYJ335 derivative containing yvaV and opuB operonThis study
pYJ-opuDpYJ335 derivative containing opuDThis study
pYJ-opuEpYJ335 derivative containing opuEThis study


Comparative Genomic Analyses

For comparative genomic analysis of W. coagulans and four Bacillus species, which were mainly isolated from fermented foods, genome sequence data were obtained from the NCBI (http://ncbi.nlm.nih.gov/genomes)(Table 2). Genes were predicted using the RAST server for SEED-based automated annotation [40]. The predicted genes of the strains were confirmed using CLgenomics ver. 1.55 software (CJ Bioscience, Republic of Korea) and the iPath (ver. 3) module [41].

Table 2 . Genomic features of strains of Weizmannia coagulans and four Bacillus species..

SpeciesStrainSize (bp)G+C content (mol%)OriginCountryAccession no.Reference
W. coagulansKCTC 3625T3,366,99546.90Dairy (evaporated milk)USANZ_CP009709[22]
ASRS2173,514,33046.47Rice strawSouth KoreaNZ_CP058594[23]
HM-083,624,64146.30Healthy chicken intestineChinaNZ_CP010525[24]
IDCC12013,664,21546.20Green maltSouth KoreaNZ_CP035305[9]
DSM 23143,628,65146.24RhizosphereunknownNZ_CP033687[25]
B. licheniformisKCCM 12145T4,222,59746.20UnknownunknownNZ_CP034569[26]
0DA23-14,405,37346.00DoenjangSouth KoreaNZ_CP031126[27]
14ADL44,332,23245.90DoenjangSouth KoreaNZ_CP026673[18]
MCC 25144,230,48046.20Raw milk (sheep)IndiaNZ_CP038186[28]
TCCC 111484,341,07645.90SoilunknownNZ_CP033218[29]
B. siamensisKCTC 13613T3,779,69646.30Salted crabSouth KoreaAJVF01000000-51[30]
B283,946,17845.89KimchiSouth KoreaNZ_CP066219-21[19]
SCSIO 057464,268,31645.98Sea mudIndian OceanNZ_CP025001[31]
B. subtilisKCCM 32835T4,215,60743.34Soil under a mango treeunknownNZ_CP020102-3[32]
SRCM1027484,210,79743.60KimchiSouth KoreaNZ_CP028212[33]
PS8324,215,36743.50SoilunknownNZ_CP010053[34]
HRBS-10TDI134,186,26943.29Soybean pasteSouth KoreaNZ_CP015222-
GFR-124,202,95543.30Chung-gook-jangSouth KoreaNZ_CP032852[35]
B. velezensisKCTC 13012T4,034,33546.30River VelezSpainNZ_LLZC01000001-24[36]
DMB053,262,56346.25MejuSouth KoreaNZ_CP083715-7[37]
DMB064,157,94546.20DoenjangSouth KoreaNZ_CP083763[38]
DMB074,157,94545.60MejuSouth KoreaNZ_CP083764-
KMU013,932,43746.50KimchiSouth KoreaNZ_CP063768[39]

- mean that there are no papers published.

DNA Cloning and Transformation

Plasmids and genomic DNA of E. coli, B. subtilis, and W. coagulans were extracted with an Inclone Plasmid Mini Prep Kit (Inclone Biotech, Republic of Korea) and a DNeasy Tissue Kit (Qiagen, Germany), respectively, according to the manufacturers’ instructions. B. subtilis and W. coagulans were treated with lysozyme (0.1 g/ml) at 37°C for 1h before DNA extraction.

Genes related to the Opu system from B. velezensis DMB07 were amplified by PCR using primer sets containing the appropriate restriction enzyme sites for insertion into pLipSM or pYJ335 (Table 3). PCR amplifications were performed using a T3000 thermocycler (Biometra, Germany) [42] and an Inclone Taq Polymerase Kit (Inclone Biotech) according to the manual. PCR primers were designed based on Opu system genes and nearby sequences of B. velezensis strain DMB07 (Table 3). All PCRs were performed using 30 cycles of denaturing at 95°C for 1 min, annealing at 63°C for 1.5 min, and elongation at 72°C for 1.5 min. Amplicons were digested by appropriate enzymes and inserted into same sites of pLipSM or pYJ335. Constructed plasmids were verified by PCR using pLipSM-check-F primer or pYJ335-check-F primer and DNA sequencing. Constructed plasmids derived from pYJ335 were introduced into E. coli DH5α (Stratagene, USA) by the method of Hanahan and Meselson [43], and then into W. coagulans KCTC 3625T (KCTC; Korean Collection for Type Cultures, South Korea) by electroporation [44] with a gene pulser (Bio-Rad, USA). For introduction into B. subtilis ISW1214 of pLipSM-derived plasmids, DNA extracted from E. coli BL21 (DE3) (New England Biolabs, USA) was used [20].

Table 3 . Oligonucleotides used in this study..

OligonucleotideSequence (5 → 3)aUseAmplified size (bp)
plipSM vector
opuAA-BamHI-F’CGGGATCCGCCTGATAAAAGCCCGGTTTCCopuAA upstream3,367
opuAC-SmaI-R’TCCCCCGGGGGATGAACCTCTTGTGACAACCopuAC downstream
opuBA-BamHI-F’CGCGTCGACGCTCATTTGATTACCCCTCTGCopuBA upstream3,747
opuBD-SalI-R’CGGGATCCCCGGTCAATACGGGTAAATCopuBD downstream
yvaV-BamHI-F’CGGGATCCGAAAAAACGAACCAAAGCGCCGyvaV downstream4,405
opuD-BamHI-F’CGGGATCCCGTCCCCGTTGATAATTGACCopuD upstream1,787
opuD-SalI-R’ACGCGTCGACCCTGTGATCCTGAAGGTGAGCopuD downstream
opuE-EcoRI-F’CGCAATTCGGTTTAGTAACCATAGCCGGCopuE upstream1,746
opuE-BamHI-R’CGGGATCCGCTCAATTTGCACAGCACCTCCopuE downstream
plipSM-check-F’CCAGCCGAAAGAAGCCAAAGCHpa II promoter downstream, upstream of insertion site
pYJ335 vector
opuAA-KpnI-F’CCGGTACCGCCTGATAAAAGCCCGGTTTCCopuAA upstream3,367
opuAC-KpnI-R’CCGGTACCGGATGAACCTCTTGTGACAACCopuAA downstream
opuBA-KpnI-F’CCGGTACCGCTCATTTGATTACCCCTCTGCopuBA upstream3,747
opuBD-KpnI-R’CCGGTACCCCGGTCAATACGGGTAAATCopuBD downstream
yvaV-KpnI-F’CCGGTACCGAAAAAACGAACCAAAGCGCCGyvaV downstream4,405
opuD-KpnI-F’CCGGTACCCGTCCCCGTTGATAATTGACCopuD upstream1,787
opuD-KpnI-R’CCGGTACCCCTGTGATCCTGAAGGTGAGCopuD downstream
opuE-KpnI-F’CCGGTACCGGTTTAGTAACCATAGCCGGCopuE upstream1,746
opuE-KpnI-R’CCGGTACCGCTCAATTTGCACAGCACCTCCopuE downstream
pYJ335-check-F’GCGATTAAGTTGGGTAACGCKpnI site upstream of pYJ335

aRestriction sites are underline..

Determination of Salt Tolerance

Salt tolerance of the strains in this study was determined by examining growth on TSA supplemented with up to 14% NaCl (w/v, final concentration). Growth on 0.5% (the NaCl concentration in normal TSA), 3.5%, 7%, 10.5%, and 14% NaCl was determined after incubation for 1, 2, 3, 4, and 5 days. The experiment was performed three times, independently.

Results and Discussion

Growth of W. coagulans on TSA

W. coagulans originally belonged to the genus Bacillus but was later reclassified. Most Bacillus species can grow on medium supplemented with >7% NaCl (w/v, final concentration) [45-47]. In contrast, W. coagulans does not grow at a salt concentration of >3% [17]. To reconfirm this, the growth of W. coagulans was checked in different salt conditions. As shown in Fig. 1, W. coagulans grew well on TSA without added extra salt (TSA contains 0.5%NaCl), while it did not grow on TSA with final NaCl concentrations of 3.5% or 7%. In contrast, B. licheniformis, B. siamensis, B. subtilis, and B. velezensis grew on TSA with a final NaCl concentration of 7% (Fig. 1).

Figure 1. Effect of NaCl on growth of Weizmannia coagulans and four Bacillus species. Tryptic soy agar (TSA) containing 0%–7% (w/v) NaCl was used for the detection of growth. Strains: W1, W. coagulans KCTC 3625T; W2, W. coagulans ASRS217; L1, B. licheniformis KCCM 12145T; L2, B. licheniformis 0DA23-1; Si1, B. siamensis KCTC 13613T; Si2, B. siamensis B28; Su1, B. subtilis KCCM 32835T; Su2, B. subtilis SRCM102748; V1, B. velezensis KCTC 13012T; V2, B. velezensis DMB07.

Comparative Genomic Analysis of Salt Tolerance

B. licheniformis, B. siamensis, B. subtilis, and B. velezensis are predominantly isolated from fermented soybean products such as meju and doenjang [45, 48]. The enzymatic activities of these species contribute to the development of sensory properties of the fermented foods. Therefore, several studies have reported analysis of these strains for use as starters [38, 49, 50]. W. coagulans is also isolated from several foods and exhibits protease and lipase activities, so it was judged that it could improve the sensory properties of fermented foods. However, W. coagulans is sensitive to salt compared with the four Bacillus species. Therefore, we undertook comparative genomic analysis of these species, looking for factors that affect their salt tolerance (Table 2).

To resist osmotic stress, many bacteria accumulate compatible solutes such as choline, glycine betaine, and proline betaine through uptake from outside the cell via transporters including osmoprotectant uptake (Opu) transporter [51, 52]. The Opu system is known to be involved in salt resistance [51]. W. coagulans genomes possess the OpuC system. Meanwhile, B. licheniformis encodes four Opu systems, and B. siamensis, B. subtilis, and B. velezensis possess five Opu systems (Fig. 2). OpuA, OpuB, and OpuC belong to the ATP-binding cassette transporter superfamily, and OpuD and OpuE are single-component transporters belonging to the BCCT (Betaine/Carnitine/Choline Transporters) family [51]. In the current study, the encoded OpuA, OpuB, and OpuC systems were found to contain the common substrate-binding, transporter, and ATP-binding proteins. Although Hoffmann and Berner reported that Bacillus species contain five Opu systems [51], B. licheniformis genomes lack the OpuB system. Our results suggest that the low salt-tolerance of W. coagulans compared with high salt-tolerance of Bacillus species is due to it only having one Opu system.

Figure 2. Predicted mechanism of salt-sensitivity of W. coagulans based comparative genomic analysis with four Bacillus species. Compatible solutes are depicted in black text in yellow boxes. Color coding indicates which species contain which opu genes.

Opu Systems Enhance the Salt Tolerance of B. subtilis

As a result of the comparative genome analysis, the salt-sensitivity of W. coagulans was reasoned to arise from a deficiency in Opu systems. To test that, we aimed to introduce “absent” genes into W. coagulans to determine the effect on salt resistance. Plasmid pLipSM is an E. coli/Bacillus shuttle vector [20]. Although W. coagulans has been reclassified from genus Bacillus, this plasmid is also functional in Weizmannia. opu genes from B. velezensis DMB07 (which contains all the opu genes and had the highest salt resistance among the strains we tested) were cloned and introduced into W. coagulans via this plasmid. Note that we did not clone opuC from B. velezensis DMB07 because W. coagulans naturally possesses this system (see section 2.2). The obtained recombinant plasmids were designated pL-opuA, pL-opuB, pL-opuD, and pL-opuE, respectively. In addition, pL-opurB was reconstructed with the opuB operon and the yvaV gene, which is a regulator for expression of the opuB operon (Fig. 3A).

Figure 3. Construction of pLip-SM-derived plasmids containing opu genes from B. velezensis DMB07 (A) and salt-tolerance of B. subtilis containing these plasmids (B). TSA containing up to 14% NaCl (w/v, final concentration) was used for the detection of growth.

Because W. coagulans strain KCTC 3625T is a wild-type, it was not expected to be easy to introduce recombinant plasmids into the strain, so they were first introduced into laboratory strain B. subtilis ISW1214. We tested whether the protein expression vectors had an effect on the salt resistance of transformed B. subtilis ISW1214. As shown in Fig. 3B, wild-type B. subtilis ISW1214 grew in medium containing 7% NaCl, but not in medium containing 10.5% or 14% NaCl. However, when any one of the B. velezensis Opu systems was overexpressed, the resulting strain grew on 14% NaCl. The multicomponent systems OpuA and OpuB enabled better growth on 14%NaCl than the single-component systems OpuD and OpuE (Fig. 3B).

Opu Systems Confer Salt Tolerance to W. coagulans

pLipSM-based plasmids produced in B. subtilis were purified and introduced into W. coagulans KCTC 3625T, but W. coagulans KCTC 3625T showed resistance to low concentrations of kanamycin, which is the selection marker in pLipSM, so it was not easy to select W. coagulans transformants containing pLipSM-derived plasmids. Accordingly, we tried to introduce opu genes into W. coagulans KCTC 3625T by using pYJ335, which has the erythromycin resistance gene as a selection marker. The replicon of plasmid pYJ335 was derived from pUC19 and pE194 fragments [21]. The replicon can be cloned from lactic acid bacteria and Staphylococcus [53]. The opu genes were amplified from B. velezensis DMB07 in the same way as in the previous experiment (see section 3.3), and recombinant plasmids were generated by inserting the opuA and opuB operons, and opuD and opuE genes, to produce pYJ-opuA, pYJ-opuB, pYJ-opuD, and pYJ-opuE (Fig. 4A). The vector containing the opuB operon, including the yvaV gene, which is a regulator for expression of the opuB operon, was named pYJ-opurB. These vectors were each transformed directly into W. coagulans (without going through B. subtilis). All the transformed strains grew in medium with 7% NaCl added, and all except the OpuB-containing transformants grew in 10.5%salt (Fig. 4B).

Figure 4. Construction of pYJ335-derived plasmids containing opu genes from B. velezensis DMB07 (A) and salt-tolerance of W. coagulans containing these plasmids (B). de Man, Rogosa, and Sharpe medium containing up to 10.5% NaCl (w/v, final concentration) was used for the detection of growth.

In previous studies, 67.7% and 71.0% of W. coagulans strains showed protease and lipase activities, respectively; these activities produce amino acids and fragrance components from lipids, respectively [17]. In addition, it can be predicted that all the strains of W. coagulans have production performance in the condition containing NaCl, and that most strains can inhibit the growth of other microorganisms via antibacterial activity [17] However, the W. coagulans strains were sensitive to salt. Most fermented foods contain a significant salt content. Therefore, even though W. coagulans is widely distributed in the environment [3, 9-11, 54, 55] and in the raw materials used to prepare fermented foods, detection of this species is lowered in foods with added salt [17]. If W. coagulans were to be salt-resistant, it would be expected to play a greater role in fermented food production. Here, the genetic basis of the sensitivity of W. coagulans to salt, i.e. a deficiency in Opu systems, was determined. These results will help with screening for salt-resistant strains.

Acknowledgments

This work was supported by the National Research Foundation of Korea (NRF) [NRF-2022M3A9I3082364].

Conflict of Interest

The authors have no financial conflicts of interest to declare.

Fig 1.

Download
Figure 1.Effect of NaCl on growth of Weizmannia coagulans and four Bacillus species. Tryptic soy agar (TSA) containing 0%–7% (w/v) NaCl was used for the detection of growth. Strains: W1, W. coagulans KCTC 3625T; W2, W. coagulans ASRS217; L1, B. licheniformis KCCM 12145T; L2, B. licheniformis 0DA23-1; Si1, B. siamensis KCTC 13613T; Si2, B. siamensis B28; Su1, B. subtilis KCCM 32835T; Su2, B. subtilis SRCM102748; V1, B. velezensis KCTC 13012T; V2, B. velezensis DMB07.
Journal of Microbiology and Biotechnology 2024; 34: 1443-1451https://doi.org/10.4014/jmb.2404.04016

Fig 2.

Download
Figure 2.Predicted mechanism of salt-sensitivity of W. coagulans based comparative genomic analysis with four Bacillus species. Compatible solutes are depicted in black text in yellow boxes. Color coding indicates which species contain which opu genes.
Journal of Microbiology and Biotechnology 2024; 34: 1443-1451https://doi.org/10.4014/jmb.2404.04016

Fig 3.

Download
Figure 3.Construction of pLip-SM-derived plasmids containing opu genes from B. velezensis DMB07 (A) and salt-tolerance of B. subtilis containing these plasmids (B). TSA containing up to 14% NaCl (w/v, final concentration) was used for the detection of growth.
Journal of Microbiology and Biotechnology 2024; 34: 1443-1451https://doi.org/10.4014/jmb.2404.04016

Fig 4.

Download
Figure 4.Construction of pYJ335-derived plasmids containing opu genes from B. velezensis DMB07 (A) and salt-tolerance of W. coagulans containing these plasmids (B). de Man, Rogosa, and Sharpe medium containing up to 10.5% NaCl (w/v, final concentration) was used for the detection of growth.
Journal of Microbiology and Biotechnology 2024; 34: 1443-1451https://doi.org/10.4014/jmb.2404.04016

Table 1 . Bacterial strains and plasmids used in this study..

Strain/plasmidRelevant characteristic(s)Source or reference
Strain
W. coagulans
KCTC 3625TWeizmannia coagulans type strain, wild-type strainKorean Collection for Type
Cultures (KCTC), South Korea
ASRS217Potential starter candidate, isolated from rice straw[17]
B. licheniformis
KCCM 12145TBacillus licheniformis type strainKorean Culture Center of
Microorganisms (KCCM), South Korea
0DA23-1Potential starter candidate, isolated from commercial doenjang[18]
B. siamensis
KCTC 13613TB. siamensis type strainKCTC, South Korea
B28Potential starter candidate, isolated from kimchi[19]
B. subtilis
KCCM 32835TB. subtilis type strainKCCM, South Korea
SRCM102748Isolated from kimchiSRCM, South Korea
ISW1214hsrM1, leuA8, metB5, Tet5Takara Bio, Japan
B. velezensis
KCTC 13012TB. velezensis type strainKCTC, South Korea
DMB07Isolated from fermented soybeanUnpublished results
E. coli
DH5αEscherichia coli, cloning host for recombinant plasmidsStratagene, USA
BL21 (DE3)E. coli recA+ strain, host for protein expressionNEB, USA
Plasmid
pLipSME. coli–Bacillus shuttle vector, cloning vector, Ampr, Kanr[20]
pL-opuApLipSM derivative containing opuA operonThis study
pL-opuBpLipSM derivative containing opuB operonThis study
pL-opurBpLipSM derivative containing yvaV and opuB operonThis study
pL-opuDpLipSM derivative containing opuDThis study
pL-opuEpLipSM derivative containing opuEThis study
pYJ335E. coli–staphylococcal shuttle vector, Ampr, Eryr[21]
pYJ-opuApYJ335 derivative containing opuA operonThis study
pYJ-opuBpYJ335 derivative containing opuB operonThis study
pYJ-opurBpYJ335 derivative containing yvaV and opuB operonThis study
pYJ-opuDpYJ335 derivative containing opuDThis study
pYJ-opuEpYJ335 derivative containing opuEThis study

Table 2 . Genomic features of strains of Weizmannia coagulans and four Bacillus species..

SpeciesStrainSize (bp)G+C content (mol%)OriginCountryAccession no.Reference
W. coagulansKCTC 3625T3,366,99546.90Dairy (evaporated milk)USANZ_CP009709[22]
ASRS2173,514,33046.47Rice strawSouth KoreaNZ_CP058594[23]
HM-083,624,64146.30Healthy chicken intestineChinaNZ_CP010525[24]
IDCC12013,664,21546.20Green maltSouth KoreaNZ_CP035305[9]
DSM 23143,628,65146.24RhizosphereunknownNZ_CP033687[25]
B. licheniformisKCCM 12145T4,222,59746.20UnknownunknownNZ_CP034569[26]
0DA23-14,405,37346.00DoenjangSouth KoreaNZ_CP031126[27]
14ADL44,332,23245.90DoenjangSouth KoreaNZ_CP026673[18]
MCC 25144,230,48046.20Raw milk (sheep)IndiaNZ_CP038186[28]
TCCC 111484,341,07645.90SoilunknownNZ_CP033218[29]
B. siamensisKCTC 13613T3,779,69646.30Salted crabSouth KoreaAJVF01000000-51[30]
B283,946,17845.89KimchiSouth KoreaNZ_CP066219-21[19]
SCSIO 057464,268,31645.98Sea mudIndian OceanNZ_CP025001[31]
B. subtilisKCCM 32835T4,215,60743.34Soil under a mango treeunknownNZ_CP020102-3[32]
SRCM1027484,210,79743.60KimchiSouth KoreaNZ_CP028212[33]
PS8324,215,36743.50SoilunknownNZ_CP010053[34]
HRBS-10TDI134,186,26943.29Soybean pasteSouth KoreaNZ_CP015222-
GFR-124,202,95543.30Chung-gook-jangSouth KoreaNZ_CP032852[35]
B. velezensisKCTC 13012T4,034,33546.30River VelezSpainNZ_LLZC01000001-24[36]
DMB053,262,56346.25MejuSouth KoreaNZ_CP083715-7[37]
DMB064,157,94546.20DoenjangSouth KoreaNZ_CP083763[38]
DMB074,157,94545.60MejuSouth KoreaNZ_CP083764-
KMU013,932,43746.50KimchiSouth KoreaNZ_CP063768[39]

- mean that there are no papers published.

Table 3 . Oligonucleotides used in this study..

OligonucleotideSequence (5 → 3)aUseAmplified size (bp)
plipSM vector
opuAA-BamHI-F’CGGGATCCGCCTGATAAAAGCCCGGTTTCCopuAA upstream3,367
opuAC-SmaI-R’TCCCCCGGGGGATGAACCTCTTGTGACAACCopuAC downstream
opuBA-BamHI-F’CGCGTCGACGCTCATTTGATTACCCCTCTGCopuBA upstream3,747
opuBD-SalI-R’CGGGATCCCCGGTCAATACGGGTAAATCopuBD downstream
yvaV-BamHI-F’CGGGATCCGAAAAAACGAACCAAAGCGCCGyvaV downstream4,405
opuD-BamHI-F’CGGGATCCCGTCCCCGTTGATAATTGACCopuD upstream1,787
opuD-SalI-R’ACGCGTCGACCCTGTGATCCTGAAGGTGAGCopuD downstream
opuE-EcoRI-F’CGCAATTCGGTTTAGTAACCATAGCCGGCopuE upstream1,746
opuE-BamHI-R’CGGGATCCGCTCAATTTGCACAGCACCTCCopuE downstream
plipSM-check-F’CCAGCCGAAAGAAGCCAAAGCHpa II promoter downstream, upstream of insertion site
pYJ335 vector
opuAA-KpnI-F’CCGGTACCGCCTGATAAAAGCCCGGTTTCCopuAA upstream3,367
opuAC-KpnI-R’CCGGTACCGGATGAACCTCTTGTGACAACCopuAA downstream
opuBA-KpnI-F’CCGGTACCGCTCATTTGATTACCCCTCTGCopuBA upstream3,747
opuBD-KpnI-R’CCGGTACCCCGGTCAATACGGGTAAATCopuBD downstream
yvaV-KpnI-F’CCGGTACCGAAAAAACGAACCAAAGCGCCGyvaV downstream4,405
opuD-KpnI-F’CCGGTACCCGTCCCCGTTGATAATTGACCopuD upstream1,787
opuD-KpnI-R’CCGGTACCCCTGTGATCCTGAAGGTGAGCopuD downstream
opuE-KpnI-F’CCGGTACCGGTTTAGTAACCATAGCCGGCopuE upstream1,746
opuE-KpnI-R’CCGGTACCGCTCAATTTGCACAGCACCTCCopuE downstream
pYJ335-check-F’GCGATTAAGTTGGGTAACGCKpnI site upstream of pYJ335

aRestriction sites are underline..

References

  1. Hammer BW. 1915. Bacteriological studies on the coagulation of evaporated milk (Vol. 17). Agricultural Experiment Station, Iowa State College of Agriculture and Mechanic Arts.
  2. Gupta RS, Patel S, Saini N, Chen S. 2020. Robust demarcation of 17 distinct Bacillus species clades, proposed as novel Bacillaceae genera, by phylogenomics and comparative genomic analyses: description of Robertmurraya kyonggiensis sp. nov. and proposal for an emended genus Bacillus limiting it only to the members of the Subtilis and Cereus clades of species. Int. J. Syst. Evol. Microbiol. 70: 5753-5798.
    Pubmed CrossRef
  3. Konuray G, Erginkaya Z. 2018. Potential use of Bacillus coagulans in the food industry. Foods 7: 92.
    Pubmed KoreaMed CrossRef
  4. Jäger R, Shields KA, Lowery RP, De Souza EO, Partl JM, Hollmer C, et al. 2016. Probiotic Bacillus coagulans GBI-30, 6086 reduces exercise-induced muscle damage and increases recovery. Peer J. 4: e2276.
    Pubmed KoreaMed CrossRef
  5. Majeed M, Majeed S, Nagabhushanam K, Natarajan S, Sivakumar A, Ali F. 2016. Evaluation of the stability of Bacillus coagulans MTCC 5856 during processing and storage of functional foods. Int. J. Food Sci. Technol. 51: 894-901.
    CrossRef
  6. Ratna Sudha, M Yelikar KA, Deshpande S. 2012. Clinical study of Bacillus coagulans unique IS-2 (ATCC PTA-11748) in the treatment of patients with bacterial vaginosis. Indian J. Microbiol. 52: 396-399.
    Pubmed KoreaMed CrossRef
  7. Elshaghabee FMF, Rokana N, Gulhane RD, Sharma C, Panwar H. 2017. Bacillus as potential probiotics: status, concerns, and future perspectives. Front. Microbiol. 8: 1490.
    Pubmed KoreaMed CrossRef
  8. Maity C, Gupta AK, Saroj DB, Biyani A, Bagkar P, Kulkarni J, et al. 2021. Impact of a gastrointestinal stable probiotic supplement Bacillus coagulans LBSC on human gut microbiome modulation. J. Diet. Suppl. 18: 577-596.
    Pubmed CrossRef
  9. Bang WY, Ban OH, Lee BS, Oh S, Park C, Park MK, et al. 2021. Genomic-, phenotypic-, and toxicity-based safety assessment and probiotic potency of Bacillus coagulans IDCC 1201 isolated from green malt. J. Ind. Microbiol. Biotechnol. 48: kuab026.
    Pubmed KoreaMed CrossRef
  10. Lee B, Lee H, Jeong DW, Lee JH. 2015. A rapid isolation method for Bacillus coagulans from rice straw. Microbiol. Biotechnol. Lett. 43: 401-404.
    CrossRef
  11. Shudong P, Guo C, Wu S, Cui H, Suo H, Duan Z. 2022. Bioactivity and metabolomics changes of plant-based drink fermented by Bacillus coagulans VHProbi C08. LWT - Food Sci. Technol. 153: 113030.
    CrossRef
  12. Babu KR, Satyanarayana T. 1995. α-Amylase production by thermophilic Bacillus coagulans in solid state fermentation. Process Biochem. 30: 305-309.
    CrossRef
  13. Olajuyigbe FM, Ehiosun KI. 2013. Production of thermostable and organic solvent-tolerant alkaline protease from Bacillus coagulans PSB-07 under different submerged fermentation conditions. Afr. J. Biotechnol. 12: 3341-3350.
  14. Le Marrec C, Hyronimus B, Bressollier P, Verneuil B, Urdaci MC. 2000. Biochemical and genetic characterization of coagulin, a new antilisterial bacteriocin in the pediocin family of bacteriocins, produced by Bacillus coagulans I4. Appl. Environ. Microbiol. 66: 5213-5220.
    Pubmed KoreaMed CrossRef
  15. EFSA. 2007. Introduction of a qualified presumption of safety (QPS) approach for assessment of selected microorganisms referred to EFSA. EFSA J. 587: 1-16.
    CrossRef
  16. Heo S, Kim T, Na HE, Lee G, Park JH, Park HJ, et al. Safety assessment systems for microbial starters derived from fermented foods. J. Microbiol. Biotechnol. 32: 1227-1233.
    Pubmed KoreaMed CrossRef
  17. Kim YS, Lee J, Heo S, Lee JH, Jeong DW. 2021. Technology and safety evaluation of Bacillus coagulans exhibiting antimicrobial activity for starter development. LWT - Food Sci. Technol. 137: 110464.
    CrossRef
  18. Jeong DW, Lee B, Lee J H. 2018. Complete genome sequence of Bacillus licheniformis 14ADL4 exhibiting resistance to clindamycin. Korean J. Microbiol. 54: 169-170.
  19. Heo S, Kim JH, Kwak MS, Jeong DW, Sung MH. 2021. Functional genomic insights into probiotic Bacillus siamensis strain B28 from traditional Korean fermented kimchi. Foods 10: 1906.
    Pubmed KoreaMed CrossRef
  20. Lee MH, Song JJ, Choi YH, Hong SP, Rha E, Kim HK, et al. 2003. High-level expression and secretion of Bacillus pumilus lipase B26 in Bacillus subtilis Chungkookjang. J. Microbiol. Biotechnol. 13: 892-896.
  21. Ji Y, Marra A, Rosenberg M, Woodnutt G. 1999. Regulated antisense RNA eliminates alpha-toxin virulence in Staphylococcus aureus infection. J. Bacteriol. 181: 6585-6590.
    Pubmed KoreaMed CrossRef
  22. Johnson SL, Bishop-Lilly KA, Ladner JT, Daligault HE, Davenport KW, Jaissle J, et al. 2015. Complete genome sequences for 59 Burkholderia isolates, both pathogenic and near neighbor. Genome Announc. 3: e00159-15.
    Pubmed KoreaMed CrossRef
  23. Lee J, Heo S, Kim Y S, Lee JH, Jeong DW. 2020. Complete genome sequence of Bacillus coagulans strain ASRS217, a potential food fermentation starter culture. Korean J. Microbiol. 56: 321-323.
  24. Yao G, Gao P, Zhang W. 2016. Complete genome sequence of probiotic Bacillus coagulans HM-08: a potential lactic acid producer. J. Biotechnol. 228: 71-72.
    Pubmed CrossRef
  25. Maas RH, Bakker RR, Jansen ML, Visser D, Jong E, Eggink G, et al. 2008. Lactic acid production from lime-treated wheat straw by Bacillus coagulans: neutralization of acid by fed-batch addition of alkaline substrate. Appl. Microbiol. Biotechnol. 78: 751-758.
    Pubmed KoreaMed CrossRef
  26. Rey MW, Ramaiya P, Nelson BA, Brody-Karpin SD, Zaretsky EJ, Tang M, et al. 2004. Complete genome sequence of the industrial bacterium Bacillus licheniformis and comparisons with closely related Bacillus species. Genome Biol. 5: R77.
    Pubmed KoreaMed CrossRef
  27. Jeong DW, Lee B, Heo S, Jang M, Lee JH. 2018. Complete genome sequence of Bacillus licheniformis strain 0DA23-1, a potential starter culture candidate for soybean fermentation. Korean J. Microbiol. 54: 453-455.
  28. Rohith HS, Halami PM. 2021. The combined effect of potential probiotic Bacillus licheniformis MCC 2514 and Bifidobacterium breve NCIM 5671 towards anti-inflammatory activity on HT-29 cell lines. Probiotics Antimicrob. Proteins 15: 351-362.
    Pubmed CrossRef
  29. Yuan F, Li K, Zhou C, Zhou H, Liu H, Chai H, et al. 2020. Identification of two novel highly inducible promoters from Bacillus licheniformis by screening transcriptomic data. Genom 112: 1866-1871.
    Pubmed CrossRef
  30. Jeong H, Jeong DE, Kim SH, Song GC, Park SY, Ryu CM, et al. 2012. Draft genome sequence of the plant growth-promoting bacterium Bacillus siamensis KCTC 13613T. J. Bacteriol. 194: 4148-4149.
    Pubmed KoreaMed CrossRef
  31. Pan H, Tian X, Shao M, Xie Y, Huang H, Hu J, et al. 2019. Genome mining and metabolic profiling illuminate the chemistry driving diverse biological activities of Bacillus siamensis SCSIO 05746. Appl. Microbiol. Biotechnol. 103: 4153-4165.
    Pubmed CrossRef
  32. Nye TM, Schroeder JW, Kearns DB, Simmons LA. 2017. Complete genome sequence of undomesticated Bacillus subtilis strain NCIB 3610. Genome Announc. 5: e00364-17.
    Pubmed KoreaMed CrossRef
  33. Iqbal S, Ullah N, Janjua HA. 2021. In vitro evaluation and genome mining of Bacillus subtilis strain RS10 reveals its biocontrol and plant growth-promoting potential. Agriculture 11: 1273.
    CrossRef
  34. Grela A, Jamrozek I, Hubisz M, Iwanicki A, Hinc K, Kazmierkiewicz R, et al. 2018. Positions 299 and 302 of the GerAA subunit are important for function of the GerA spore germination receptor in Bacillus subtilis. PLoS One 13: e0198561.
    Pubmed KoreaMed CrossRef
  35. Heo J, Kim JS, Hong SB, Park BY, Kim SJ, Kwon SW. 2019. Genetic marker gene, recQ, differentiating Bacillus subtilis and the closely related Bacillus species. FEMS Microbiol. Lett. 366: fnz172.
    Pubmed CrossRef
  36. Dunlap CA, Kim SJ, Kwon SW, Rooney AP. 2016. Bacillus velezensis is not a later heterotypic synonym of Bacillus amyloliquefaciens; Bacillus methylotrophicus, Bacillus amyloliquefaciens subsp. plantarum and 'Bacillus oryzicola' are laterheterotypic synonyms of Bacillus velezensis based on phylogenomics. Int. J. Syst. Evol. Microbiol. 66: 1212-1217.
    Pubmed CrossRef
  37. Na HE, Heo S, Kim T, Lee G, Lee JH, Jeong DW. 2023. ComQXPA quorum-sensing systems contribute to enhancing the protease activity of Bacillus velezensis DMB05 from fermented soybeans. Int. J. Food Microbiol. 401: 110294.
    Pubmed CrossRef
  38. Na HE, Heo S, Kim YS, Kim T, Lee G, Lee JH, et al. 2022. The safety and technological properties of Bacillus velezensis DMB06 used as a starter candidate were evaluated by genome analysis. LWT - Food Sci. Technol. 161: 113398.
    CrossRef
  39. Heo S, Kim JH, Kwak MS, Sung MH, Jeong DW. 2021. Functional annotation genome unravels potential probiotic Bacillus velezensis strain KMU01 from traditional Korean fermented kimchi. Foods 10: 563.
    Pubmed KoreaMed CrossRef
  40. Aziz RK, Bartels D, Best AA, DeJongh M, Disz T, Edwards RA, et al. 2008. The RAST Server: rapid annotations using subsystems technology. BMC Genom. 9: 75.
    Pubmed KoreaMed CrossRef
  41. Darzi Y, Letunic I, Bork P, Yamada T. 2018. iPath3.0: interactive pathways explorer v3. Nucleic Acids Res. 46: W510-W513.
    Pubmed KoreaMed CrossRef
  42. Abbas BA, Khudor MH, Saeed BMS. 2014. Detection of hbl, nhe and bceT toxin genes in Bacillus cereus isolates by multiplex PCR. Int. J. Curr. Microbiol. Appl. Sci. 3: 1009-1016.
  43. Hanahan D, Meselson M. 1983. Plasmid screening at high colony density. Methods Enzymol. 100: 333-342.
    Pubmed CrossRef
  44. Kraemer GR, Iandolo JJ. 1990. High-frequency transformation of Staphylococcus aureus by electroporation. Curr. Microbiol. 21: 373-376.
    CrossRef
  45. Jeong DW, Kim HR, Jung G, Han S, Kim CT, Lee JH. 2014. Bacterial community migration in the ripening of doenjang, a traditional Korean fermented soybean food. J. Microbiol. Biotechnol. 24: 648-660.
    Pubmed CrossRef
  46. Jeong DW, Jeong M, Lee JH. 2017. Antibiotic susceptibilities and characteristics of Bacillus licheniformis isolates from traditional Korean fermented soybean foods. LWT - Food Sci. Technol. 75: 565-568.
    CrossRef
  47. Kim T, Heo S, Na HE, Lee G, Kim JH, Kwak MS, et al. 2022. Bacterial community of galchi-baechu kimchi based on culturedependent and -independent investigation and selection of starter candidates. J. Microbiol. Biotechnol. 32: 341-347.
    Pubmed KoreaMed CrossRef
  48. Kim YS, Kim MC, Kwon SW, Kim SJ, Park IC, Ka JO, et al. 2011. Analyses of bacterial communities in meju, a Korean traditional fermented soybean bricks, by cultivation-based and pyrosequencing methods. J. Microbiol. Biotechnol. 49: 340-348.
    Pubmed CrossRef
  49. Jeon HH, Jung JY, Chun BH, Kim MD, Baek SY, Moon JY, et al. 2016. Screening and characterization of potential Bacillus starter cultures for fermenting low-salt soybean paste (Doenjang). J. Microbiol. Biotechnol. 26: 666-674.
    Pubmed CrossRef
  50. Lee MY, Park SY, Jung KO, Park KY, Kim SD. 2005. Quality and functional characteristics of chungkukjang prepared with various Bacillus sp. isolated from traditional chungkukjang. J. Food Sci. 70: M191-M196.
    CrossRef
  51. Hoffmann T, Bremer E. 2017. Guardians in a stressful world: the Opu family of compatible solute transporters from Bacillus subtilis. Biol. Chem. 398: 193-214.
    Pubmed CrossRef
  52. Heo S, Lee J, Lee JH, Jeong DW. 2019. Genomic insight into the salt tolerance of Enterococcus faecium, Enterococcus faecalis and Tetragenococcus halophilus. J. Microbiol. Biotechnol. 29: 151-1602.
    Pubmed CrossRef
  53. Peterbauer C, Maischberger T, Haltrich D. 2011. Food-grade gene expression in lactic acid bacteria. Biotechnol. J. 6: 1147-1161.
    Pubmed CrossRef
  54. Wang L, Xue Z, Zhao B, Yu B, Xu P, Ma Y. 2013. Jerusalem artichoke powder: a useful material in producing high-optical-purity Llactate using an efficient sugar-utilizing thermophilic Bacillus coagulans strain. Bioresour. Technol. 130: 174-180.
    Pubmed CrossRef
  55. Xing SC, Chen JY, Lv N, Mi JD, Chen WL, Liang JB, et al. 2018. Biosorption of lead (Pb2+) by the vegetative and decay cells and spores of Bacillus coagulans R11 isolated from lead mine soil. Chemosphere 211: 804-816.
    Pubmed CrossRef