Articles Service
Research article
Codon Optimization, Soluble Expression and Purification of PE_PGRS45 Gene from Mycobacterium tuberculosis and Preparation of Its Polyclonal Antibody Protein
1Department of Clinical Laboratory, School of Laboratory Medicine, Bengbu Medical College, Bengbu, Anhui 233000, P.R. China 2Anhui Province Key Laboratory of Immunology in Chronic Diseases, Anhui Key Laboratory of Infection and Immunity, School of Laboratory Medicine, Bengbu Medical College, Bengbu, Anhui 233000, P.R. China 3Department of Histology and Embryology, Bengbu Medical College, Bengbu, Anhui 233000, P.R. China 4The Infectious Disease Hospital of Bengbu City, Bengbu, Anhui 233000, P.R. China
Correspondence to:J. Microbiol. Biotechnol. 2021; 31(11): 1583-1590
Published November 28, 2021 https://doi.org/10.4014/jmb.2106.06006
Copyright © The Korean Society for Microbiology and Biotechnology.
Abstract
Keywords
Graphical Abstract
Introduction
Pro-Glu (PE) and Pro-Pro-Glu (PPE) proteins are named after shared conserved proline (P) and glutamic acid (E) residues in their N-terminal motifs. PE/PPE families including 99
However, there are few reports on the biochemical function and the role of PE_PGRS45 in the pathogenic mechanism. In the present study,
Materials and Methods
Bacterial Strains, Plasmids, and Reagents
Plasmids pET-28a, pET-32a, pMAL-c5x, and host strains
Construction of Expression Plasmids
The gene sequence encoding PE_PGRS45 (
The PCR products of PE_PGRS45, pET-28a and pET-32a were digested with NcoI/XhoI, purified, and ligated with T4 DNA ligase at 16°C for 12 h. The pET-28a-PE_PGRS45 and pET-32a-PE_PGRS45 plasmids were transformed into
Expression of Recombinant Plasmids in E. coli
A single positive colony of the recombinant
The resulting cell lysates were collected and washed by centrifugation (8,000 g, 15 min, 4°C) and sonicated in PBS phosphate-buffered saline (PBS). The supernatants (periplasmic space) and precipitates (inclusion bodies) were collected, denatured at 100°C for 5 min, and analyzed by 12% SDS-PAGE followed by Coomassie Brilliant Blue staining of the gel.
Purification of MBP-PE_PGRS45 Protein
Due to the histidine sequence (6 His-tag) at the N-terminal, expression of MBP-PE_PGRS45 protein that has been added by expression plasmid purification was carried out by Nitrilotriacetic acid (Ni-NTA) agarose resin. At 12 h after induction, the cell pellet was collected by centrifugation at 8,000 g for 30 min at 4°C. Pellets were resuspended in lysis buffer (20 mM Tris-HCl, 150 mM NaCl, 1 mM phenylmethylsulfonyl fluoride (PMSF), pH 8.0), and the cells were lysed by ultrasonic homogenization. The crude supernatant cell extract was filtered through a 0.45 μm filter, and was then loaded onto a Ni-NTA agarose resin which had already been equilibrated with the lysis buffer. After loading, the pass-through was collected at a rate of 0.5 ml/min and washed with 100 ml of washing buffer (20 mM Tris-HCl, 150 mM NaCl, 20 mM imidazole, pH 8.0). Finally, the MBP-PE_PGRS45 protein bound on the Ni-NTA resin was eluted from the column with elution buffer (20 mM Tris-HCl, 150 mM NaCl, 250 mM imidazole, pH 8.0) at a flow rate of 0.5 ml/min.
To remove imidazole, the purified protein solution was transferred to a dialysis bag and dialyzed against PBS buffer overnight at 4°C with two changes during dialysis. The next day, analysis of the collected MBP-PE_PGRS45 protein and its concentration was determined based on SDS-PAGE analysis and Bradford assay, respectively. The purified MBP-PE_PGRS45 protein was estimated by densitometric analysis using ImageJ software.
Factor Xa Digestion and Purification of MBP-PE_PGRS45 Protein
The purified MBP-PE_PGRS45 protein was dialyzed against factor Xa reaction buffer (50 mM Tris, 1 mM CaCl2, 0.1% Tween-20, pH 8.0) at 4°C overnight with two changes during dialysis. After dialysis, the MBP-PE_PGRS45 protein was incubated with factor Xa protease for 36 h at 4°C to release PE_PGRS45 protein from MBP-PE_PGRS45 protein. The above cleavage mixture was passed through a Ni-NTA agarose resin, then collect MBP removed MBP-PE_PGRS45 protein.
Production and Identification of PE_PGRS45 Polyclonal Antibody
The immunization schedule used three New Zealand white SPF rabbits. Injections were subcutaneous (SQ) as emulsions in incomplete Freund's adjuvant (IFA). The adult male New Zealand white rabbits were first immunized subcutaneously with 400 μg PE_PGRS45 protein with an equal volume of IFA, and booster immunization was performed every 2 weeks for a total of 4 immunizations. Blood was collected 2 weeks after the end of immunization, and the titer of antiserum was determined by indirect ELISA method, after which blood was collected from the heart and the serum was separated. The main steps to collect blood from the heart included: 1) The New Zealand white rabbit was placed on its back and its limbs were tied to the animal cage. 2) The rabbit's fur on the left side of the chest was trimmed away and the skin was disinfected. 3) Pressing the left thumb against the xiphoid process of the sternum, the index and middle fingers were placed on the right chest, gently pushing the heart to the left to fix the heart on the left chest, and then the strongest part of the heart was touched with the left thumb. 4) Next, a 50 ml syringe (connected with a 16-gauge needle) tilted at a 45-degree angle was used to pierce the heart and draw blood from the strongest part of the heartbeat. 5) The blood drawn was immediately and poured into a sterile Erlenmeyer flask, and the serum was separated after coagulation. 6) The New Zealand white rabbits were sacrificed by injecting air into the ear vein. 7) The antibody production protocol was reviewed and approved by the Animal Ethics Committee of Bengbu Medical College (Approval No. 2020-127).
Antibody titer was measured using an indirect enzyme-linked immunosorbent assay (ELISA). The PE_PGRS45 protein (5 μg/ml) was coated on a 96-well microplate with 100 μl/well, overnight at 4°C. The coating solution was discarded and the plate was washed with PBS-Tween buffer (0.05% Tween 20 in PBS). The coated wells were blocked with 3% BSA for 1 h at 37°C. Then, the anti-PE_PGRS45 polyclonal antibody was diluted to 0.12 μg/ml, starting with 1:1000, then double-fold dilution, at 100 μl/well. This was incubated at 37°C for 1 h, and then incubated with added blocking solution, and blocked at 37°C for 1 h. The blocking solution was discarded and the plate was washed with PBST. Then, 1:5000 dilution of HRP-labeled goat anti-rabbit IgG (100 μl/well) was added and incubated at 37°C for 1 h. Finally, TMB coloring solution was added (100 μl/well), 37°C, protected from light for 15 min, and the A450 nm value was detected using a microplate reader.
Results
Sequence Analysis of PE_PGRS45
-
Fig. 1. The multiple sequence alignment of PE_PGRS45 and its orthologs.
Multiple sequence alignment between
M. tuberculosis PE_PGRS45 and its homologs was performed using BLAST.
Synthesis of the Codon-Optimized PE_PGRS45 Gene
The codon optimization of the gene sequence has a significant influence on the translation rate and overall protein production yield [15, 16]. Therefore, we investigated the codon usage of the PE_PGRS45 gene using
-
Fig. 2. Analyses of codon usage in the original PE_PGRS45 gene encoding the PE_PGRS45 protein.
The red bars present the rare codon with a frequency below 5% in
E. coli and the red arrows present the tandem or triple repeats of rare codons.
Construction of PE_PGRS45 Expression Plasmids
An exogenous gene constructed in different expression vectors and expressed in different conditions might result in disparate expression levels and distinctly different protein stabilities for the target protein [18, 19]. We thus constructed three PE_PGRS45 recombinants with varying tags of fusion to screen the optimal recombinant for expressing the target protein. The PE_PGRS45 gene was then cloned into pET-28a, pET-32a, and pMAL-c5x vectors, respectively. The restriction analysis of pET-28a-PE_PGRS45 and pET-32a-PE_PGRS45 plasmids using NcoI and XhoI released the PE_PGRS45 insert of 1,386 bp (Figs. 3A, 3B), and pMAL-c5x-PE_PGRS45 plasmid using NdeI and HindIII individually showed bands at 1,386 bp (Fig. 3C), which confirmed successful cloning of the PE_PGRS45 gene into pET-28a, pET-32a, and pMAL-c5x vectors. The sequencing results complied with the codon-optimized sequence of the synthetic PE_PGRS45 gene and confirmed that the nucleotide sequence of the inserted fragments is correct.
-
Fig. 3. Identification of recombinant plasmid.
(A) Plasmid pET-28a-PE_PGRS45 digested by NcoI/XhoI. Lane M: DNA marker; lane 1: plasmid pET-28a-PE_PGRS45 digested by NcoI/XhoI. (B) Plasmid pET-32a-PE_PGRS45 digested by NcoI/XhoI. Lane M: DNA marker; lane 1: plasmid pET-32a-PE_PGRS45 digested by NcoI/XhoI. (C) Plasmid pMAL-c5x- PE_PGRS45 digested by NdeI/HindIII. Lane M: DNA marker; lane 1: plasmid pMAL-c5x-PE_PGRS45 digested by NdeI/ HindIII.
Small-Scale Expression and Solubility Testing
The PE_PGRS45 recombinant protein was produced in
-
Fig. 4. SDS-PAGE analysis of expression of PE_PGRS45 recombinant protein by pET-28a and pET-32a expression vectors after PE_PGRS45 codon optimization.
Fusion expression of pET-28a-PE_PGRS45 in
E. coli Arctic Express (DE3) at 20°C (A) and 37°C (B). Fusion expression of pET-32a-PE_PGRS45 inE. coli Arctic Express (DE3) at 20°C (C) and 37°C (D). Lane M, Protein marker; lane 1,E. coli cells before induction; lane 2,E. coli cells after induction; lane 3, supernatant of lysate; lane 4, precipitant of lysate.
-
Fig. 5. SDS-PAGE analysis of expression of PE_PGRS45 recombinant protein by pMAL-c5x expression vectors after PE_PGRS45 codon optimization.
Fusion expression of pMAL-c5x-PE_PGRS45 in
E. coli Arctic Express (DE3) at 20°C (A) and 37°C (B). Lane M, Protein marker; lane 1,E. coli cells before induction; lane 2,E. coli cells after induction; lane 3, supernatant of lysate; lane 4, precipitant of lysate.
Purification of Recombinant MBP-PE_PGRS45 Protein
The MBP fusion construct shows high PE_PGRS45 expression levels and solubility. The filtered supernatant was accomplished by immobilized metal affinity chromatography (IMAC) on a Ni-NTA resin column to obtain MBP-PE_PGRS45. The final purity was estimated to be greater than 90% by optic densitometry of the SDS-PAGE gels (Fig. 6).
-
Fig. 6. SDS-PAGE analysis of the purified recombinant PE_PGRS45 protein. Lane M, Protein marker; lane 1, Flow fluid; lane 2, Purified PE_PGRS45.
Separation of the PE_PGRS45 Proteins from the MBP Fusion Proteins by Factor Xa Digestion
The pMAL-c5x expression vector contained factor Xa cleavage site (Ile-Glu-Gly-Arg) between the fusion partner (MBP) and the target proteins. To examine whether the MBP fusion protein could be cleaved off from the MBP-PE_PGRS45 proteins, purified MBP-PE_PGRS45 proteins were incubated with factor Xa. SDS-PAGE analysis of the factor Xa digestion showed a complete disappearance of the 82 kDa MBP-PE_PGRS45 proteins after 36 h of incubation along with an appearance of two major bands of around 43 kDa and 39 kDa (Fig. 7), indicating a cleavage of rMBP-PE_PGRS45 proteins into MBP (43 kDa) and PE_PGRS45 proteins (39 kDa).
-
Fig. 7. SDS-PAGE analysis of factor-Xa cleaved MBP-PE_PGRS45.
Lane M, Protein marker; lane 1, MBP tag (43 kDa) cleaved using the factor-Xa; lane 2, Final purified PE_PGRS45 (39 kDa).
-
Table 1 . Primers used for the construction of recombinant plasmids.
Expression vector Primer name Primer sequence (5′-3′)a Restriction site pET28a 28aFP CATG CCATGG ATGAGCTTTGTGAATGTGGCCNco I 28aRP CCG CTCGAG TTAACCATCGGCACCGTTGGTACCXho I pET32a 32aFP CATG CCATGG ATGAGCTTTGTGAATGTGGCCNco I 32aRP CCG CTCGAG TTAACCATCGGCACCGTTGGTACCXho I pMAL-c5x c5xFP GGAATT CATATG AGCTTTGTGAATGTGGCCNde I c5xRP CCC AAGCTT TTAACCATCGGCACCGTTGGTACCHind III aThe single underlined sequences indicate restriction enzyme sites.
Antiserum Titer Determination by ELISA
After the rabbits were immunized four times with the purified PE_PGRS45 (Fig. 8A), the antisera were tested at different dilutions from 1:1000 to 1:1024000 by ELISA. As shown in Fig. 8B, the absorbance value ratio of antiserum to negative serum is 2.27 when the ratio is 1:256000. Therefore, the maximum titer of the antiserum was determined to be 1:256000.
-
Fig. 8. The process of rabbit immunization (A) and indirect ELISA determined titer of anti-PE_PGRS45 polyclonal antibody (B).
Discussion
PE_PGRS45 is a 461-amino acid protein that shows a very high similarity with the N-terminal domain of PE_PGRS17 and PE_PGRS18. However, a substantial variation is observed between the amino acid sequences in the PGRS domain [13]. Corresponding verification was carried out with our prepared PE_PGRS45 antibody, and some interesting results were also obtained, but further verification is needed (Figs. S1-S3). Strong M
In the present study, His6, Trx, His6-MBP were used as fusion tags, but only MBP-PE_PGRS45 formed soluble expression. The purification using His6-MBP tag-specific binding to the Ni column is also easy to separate after the tag cleavage. Removal of the MBP fusion protein by factor-Xa cleavage did not alter the solubility of PE_PGRS45, supporting that PE_PGRS45 was properly folded and fusion protein with good purity was obtained. We used the purified PE_PGRS45 protein to immunize New Zealand rabbits and got anti-PE_PGRS45 serum. The titer was found to be higher than 1:256000. This shows that the purified PE_PGRS45 protein can induce New Zealand rabbits to produce high-titer antibodies. Therefore, the results of this study lay the basis for the further resolution of the crystal structure of PE_PGRS45, as well as the study of potential function. In addition, this will be followed by further evaluation of these specific antigens to develop highly sensitive and specific diagnostic tests for tuberculosis.
Supplemental Materials
Acknowledgments
This work was supported by Anhui Provincial Natural Science Foundation (1908085MH252, 2008085QH405), Anhui Provincial Natural Science Research Project of University (KJ2018A0233), and 512 Talent Cultivation Plan of Bengbu Medical College (by51201309).
Conflicts of Interest
The authors have no financial conflicts of interest to declare.
References
- Qian J, Chen R, Wang H, Zhang X. 2020. Role of the PE/PPE family in host-pathogen interactions and prospects for anti-tuberculosis vaccine and diagnostic tool design.
Front. Cell Infect. Microbiol. 10 : 594288. - Wang Y, Li Z, Wu S, Fleming J, Li C, Zhu G,
et al . 2021. Systematic evaluation ofMycobacterium tuberculosis proteins for antigenic properties identifies Rv1485 and Rv1705c as potential protective subunit vaccine candidates.Infect. Immun. 89 : e00585-20. - Global tuberculosis Report 2020. WHO. https://apps.who.int/iris/handle/10665/336069.
- Glaziou P. 2020. Predicted impact of the COVID-19 pandemic on global tuberculosis deaths in 2020.
medRxiv : 2020.04.28.20079582. - Cole ST, Brosch R, Parkhill J, Garnier T, Churcher C, Harris D,
et al . 1998. Deciphering the biology ofMycobacterium tuberculosis from the complete genome sequence.Nature 393 : 537-544. - Deng W, Xie J. 2012. Ins and outs of
Mycobacterium tuberculosis PPE family in pathogenesis and implications for novel measures against tuberculosis.J. Cell. Biochem. 113 : 1087-95. - De Maio F, Berisio R, Manganelli R, Delogu G. 2020. PE_PGRS proteins of
Mycobacterium tuberculosis : a specialized molecular task force at the forefront of host-pathogen interaction.Virulence 11 : 898-915. - Bottai D, Brosch R. 2009. Mycobacterial PE, PPE and ESX clusters: novel insights into the secretion of these most unusual protein families.
Mol. Microbiol. 73 : 325-328. - Cohen I, Parada C, Acosta-Gío E, Espitia C. 2014. The PGRS domain from PE_PGRS33 of
Mycobacterium tuberculosis is target of humoral immune response in mice and humans.Front. Immunol. 5 : 236. - De Maio F, Maulucci G, Minerva M, Anoosheh S, Palucci I, Iantomasi R,
et al . 2014. Impact of protein domains on PE_PGRS30 polar localization in Mycobacteria.PLoS One 9 : e112482. - Yang W, Deng W, Zeng J, Ren S, Ali MK, Gu Y,
et al . 2017.Mycobacterium tuberculosis PE_PGRS18 enhances the intracellular survival ofM. smegmatis via altering host macrophage cytokine profiling and attenuating the cell apoptosis.Apoptosis 22 : 502-509. - Deng W, Long Q, Zeng J, Li P, Yang W, Chen X,
et al . 2017.Mycobacterium tuberculosis PE_PGRS41 enhances the intracellular survival ofM. smegmatis within macrophages via blocking innate immunity and inhibition of host defense.Sci. Rep. 7 : 46716. - Karboul A, Gey van Pittius NC, Namouchi A, Vincent V, Sola C,
et al . 2006. Insights into the evolutionary history of tubercle bacilli as disclosed by genetic rearrangements within a PE_PGRS duplicated gene pair.BMC. Evol. Biol. 6 : 107. - Bachhawat N. 2018. PE-only/PE_PGRS proteins of
Mycobacterium tuberculosis contain a conserved tetra-peptide sequence DEVS/DXXS that is a potential caspase-3 cleavage motif.J. Biosci. 43 : 597-604. - Ermolaeva MD. 2001. Synonymous codon usage in bacteria.
Curr. Issues Mol. Biol. 3 : 91-97. - Sørensen MA, Kurland CG. 1989. Pedersen S. Codon usage determines translation rate in
Escherichia coli .J. Mol. Biol. 207 : 365-377. - Kopke K, Hoff B, Kück U. 2010. Application of the
Saccharomyces cerevisiae FLP/FRT recombination system in filamentous fungi for marker recycling and construction of knockout strains devoid of heterologous genes.Appl. Environ. Microbiol. 76 : 4664-4674. - Jhamb K, Sahoo DK. 2012. Production of soluble recombinant proteins in
Escherichia coli : effects of process conditions and chaperone co-expression on cell growth and production of xylanase.Bioresour. Technol. 123 : 135-143. - Tian S, Chen H, Sun T, Wang H, Zhang X, Liu Y,
et al . 2016. Expression, purification and characterization of Esx-1 secretionassociated protein EspL fromMycobacterium tuberculosis .Protein Expr. Purif. 128 : 42-51. - Yu X, Feng J, Huang L, Gao H, Liu J, Bai S,
et al . 2019. Molecular basis underlying host immunity subversion byMycobacterium tuberculosis PE/PPE family molecules.DNA. Cell Biol. 38 : 1178-1187. - Dheenadhayalan V, Delogu G, Sanguinetti M, Fadda G, Brennan MJ. 2006. Variable expression patterns of
Mycobacterium tuberculosis PE_PGRS genes: evidence that PE_PGRS16 and PE_PGRS26 are inversely regulated in vivo.J. Bacteriol. 188 : 3721-3725. - Srivastava V, Jain A, Srivastava BS, Srivastava R. 2008. Selection of genes of
Mycobacterium tuberculosis upregulated during residence in lungs of infected mice.Tuberculosis (Edinb) 88 : 171-177. - Strong M, Sawaya MR, Wang S, Phillips M, Cascio D, Eisenberg D. 2006. Toward the structural genomics of complexes: crystal structure of a PE/PPE protein complex from
Mycobacterium tuberculosis .Proc. Natl. Acad. Sci. USA 103 : 8060-8065. - Kaur J, Kumar A, Kaur J. 2018. Strategies for optimization of heterologous protein expression in
E. coli : Roadblocks and reinforcements.Int. J. Biol. Macromol. 106 : 803-822. - Young CL, Britton ZT, Robinson AS. 2012. Recombinant protein expression and purification: a comprehensive review of affinity tags and microbial applications.
Biotechnol. J. 7 : 620-634. - Arnau J, Lauritzen C, Petersen GE, Pedersen J. 2006. Current strategies for the use of affinity tags and tag removal for the purification of recombinant proteins.
Protein. Expr. Purif. 48 : 1-13. - Kosobokova EN, Skrypnik KA, Kosorukov VS. 2016. Overview of fusion tags for recombinant proteins.
Biochemistry (Mosc) 81 : 187-200. - Bach H, Mazor Y, Shaky S, Shoham-Lev A, Berdichevsky Y, Gutnick DL,
et al . 2001.Escherichia coli maltose-binding protein as a molecular chaperone for recombinant intracellular cytoplasmic single-chain antibodies.J. Mol. Biol. 312 : 79-93. - Park C, Zhou S, Gilmore J. 2007. Marqusee S: Energetics-based protein profiling on a proteomic scale: identification of proteins resistant to proteolysis.
J. Mol. Biol. 368 : 1426-1437. - Sun P, Tropea JE, Waugh, DS. 2011. Enhancing the solubility of recombinant proteins in
Escherichia coli by using hexahistidinetagged maltose-binding protein as a fusion partner.Methods Mol. Biol. 705 : 259-274. - Lee SB, Choi R, Park SK, Kim YS. 2014. Production of bioactive chicken follistatin315 in
Escherichia coli .Appl. Microbiol. Biotechnol. 98 : 10041-10051.
Related articles in JMB
Article
Research article
J. Microbiol. Biotechnol. 2021; 31(11): 1583-1590
Published online November 28, 2021 https://doi.org/10.4014/jmb.2106.06006
Copyright © The Korean Society for Microbiology and Biotechnology.
Codon Optimization, Soluble Expression and Purification of PE_PGRS45 Gene from Mycobacterium tuberculosis and Preparation of Its Polyclonal Antibody Protein
Tao Xu1,2, Minying Li2, Chutong Wang2, Meili Yuan2, Xianyou Chang4, Zhongqing Qian2, Baiqing Li2, Meiqun Sun2,3, and Hongtao Wang2*
1Department of Clinical Laboratory, School of Laboratory Medicine, Bengbu Medical College, Bengbu, Anhui 233000, P.R. China 2Anhui Province Key Laboratory of Immunology in Chronic Diseases, Anhui Key Laboratory of Infection and Immunity, School of Laboratory Medicine, Bengbu Medical College, Bengbu, Anhui 233000, P.R. China 3Department of Histology and Embryology, Bengbu Medical College, Bengbu, Anhui 233000, P.R. China 4The Infectious Disease Hospital of Bengbu City, Bengbu, Anhui 233000, P.R. China
Correspondence to:Hongtao Wang, hongtaowang@bbmc.edu.cn
Abstract
Studies have demonstrated that PE_PGRS45 is constitutively expressed under various environmental conditions (such as nutrient depletion, hypoxia, and low pH) of the in vitro growth conditions examined, indicating that PE_PGRS45 protein is critical to the basic functions of Mycobacterium tuberculosis. However, there are few reports about the biochemical function and pathogenic mechanism of PE_PGRS45 protein. The fact that this M. tuberculosis gene is not easily expressed in E. coli may be mainly due to the high content of G+C and the use of unique codons. Fusion tags are indispensable tools used to improve the soluble expression of recombinant proteins and accelerate the characterization of protein structure and function. In the present study, His6, Trx, and His6-MBP were used as fusion tags, but only MBP-PE_PGRS45 was expressed solubly. The purification using His6-MBP tag-specific binding to the Ni column was easy to separate after the tag cleavage. We used the purified PE_PGRS45 to immunize New Zealand rabbits and obtained anti- PE_PGRS45 serum. We found that the titer of polyclonal antibodies against PE_PGR45 was higher than 1:256000. The result shows that purified PE_PGRS45 can induce New Zealand rabbits to produce high-titer antibodies. In conclusion, the recombinant protein PE_PGRS45 was successfully expressed in E. coli and specific antiserum was prepared, which will be followed by further evaluation of these specific antigens to develop highly sensitive and specific diagnostic tests for tuberculosis.
Keywords: Mycobacterium tuberculosis, Rv2615c, PE_PGRS45 protein, codon optimization, soluble expression, polyclonal antibody
Introduction
Pro-Glu (PE) and Pro-Pro-Glu (PPE) proteins are named after shared conserved proline (P) and glutamic acid (E) residues in their N-terminal motifs. PE/PPE families including 99
However, there are few reports on the biochemical function and the role of PE_PGRS45 in the pathogenic mechanism. In the present study,
Materials and Methods
Bacterial Strains, Plasmids, and Reagents
Plasmids pET-28a, pET-32a, pMAL-c5x, and host strains
Construction of Expression Plasmids
The gene sequence encoding PE_PGRS45 (
The PCR products of PE_PGRS45, pET-28a and pET-32a were digested with NcoI/XhoI, purified, and ligated with T4 DNA ligase at 16°C for 12 h. The pET-28a-PE_PGRS45 and pET-32a-PE_PGRS45 plasmids were transformed into
Expression of Recombinant Plasmids in E. coli
A single positive colony of the recombinant
The resulting cell lysates were collected and washed by centrifugation (8,000 g, 15 min, 4°C) and sonicated in PBS phosphate-buffered saline (PBS). The supernatants (periplasmic space) and precipitates (inclusion bodies) were collected, denatured at 100°C for 5 min, and analyzed by 12% SDS-PAGE followed by Coomassie Brilliant Blue staining of the gel.
Purification of MBP-PE_PGRS45 Protein
Due to the histidine sequence (6 His-tag) at the N-terminal, expression of MBP-PE_PGRS45 protein that has been added by expression plasmid purification was carried out by Nitrilotriacetic acid (Ni-NTA) agarose resin. At 12 h after induction, the cell pellet was collected by centrifugation at 8,000 g for 30 min at 4°C. Pellets were resuspended in lysis buffer (20 mM Tris-HCl, 150 mM NaCl, 1 mM phenylmethylsulfonyl fluoride (PMSF), pH 8.0), and the cells were lysed by ultrasonic homogenization. The crude supernatant cell extract was filtered through a 0.45 μm filter, and was then loaded onto a Ni-NTA agarose resin which had already been equilibrated with the lysis buffer. After loading, the pass-through was collected at a rate of 0.5 ml/min and washed with 100 ml of washing buffer (20 mM Tris-HCl, 150 mM NaCl, 20 mM imidazole, pH 8.0). Finally, the MBP-PE_PGRS45 protein bound on the Ni-NTA resin was eluted from the column with elution buffer (20 mM Tris-HCl, 150 mM NaCl, 250 mM imidazole, pH 8.0) at a flow rate of 0.5 ml/min.
To remove imidazole, the purified protein solution was transferred to a dialysis bag and dialyzed against PBS buffer overnight at 4°C with two changes during dialysis. The next day, analysis of the collected MBP-PE_PGRS45 protein and its concentration was determined based on SDS-PAGE analysis and Bradford assay, respectively. The purified MBP-PE_PGRS45 protein was estimated by densitometric analysis using ImageJ software.
Factor Xa Digestion and Purification of MBP-PE_PGRS45 Protein
The purified MBP-PE_PGRS45 protein was dialyzed against factor Xa reaction buffer (50 mM Tris, 1 mM CaCl2, 0.1% Tween-20, pH 8.0) at 4°C overnight with two changes during dialysis. After dialysis, the MBP-PE_PGRS45 protein was incubated with factor Xa protease for 36 h at 4°C to release PE_PGRS45 protein from MBP-PE_PGRS45 protein. The above cleavage mixture was passed through a Ni-NTA agarose resin, then collect MBP removed MBP-PE_PGRS45 protein.
Production and Identification of PE_PGRS45 Polyclonal Antibody
The immunization schedule used three New Zealand white SPF rabbits. Injections were subcutaneous (SQ) as emulsions in incomplete Freund's adjuvant (IFA). The adult male New Zealand white rabbits were first immunized subcutaneously with 400 μg PE_PGRS45 protein with an equal volume of IFA, and booster immunization was performed every 2 weeks for a total of 4 immunizations. Blood was collected 2 weeks after the end of immunization, and the titer of antiserum was determined by indirect ELISA method, after which blood was collected from the heart and the serum was separated. The main steps to collect blood from the heart included: 1) The New Zealand white rabbit was placed on its back and its limbs were tied to the animal cage. 2) The rabbit's fur on the left side of the chest was trimmed away and the skin was disinfected. 3) Pressing the left thumb against the xiphoid process of the sternum, the index and middle fingers were placed on the right chest, gently pushing the heart to the left to fix the heart on the left chest, and then the strongest part of the heart was touched with the left thumb. 4) Next, a 50 ml syringe (connected with a 16-gauge needle) tilted at a 45-degree angle was used to pierce the heart and draw blood from the strongest part of the heartbeat. 5) The blood drawn was immediately and poured into a sterile Erlenmeyer flask, and the serum was separated after coagulation. 6) The New Zealand white rabbits were sacrificed by injecting air into the ear vein. 7) The antibody production protocol was reviewed and approved by the Animal Ethics Committee of Bengbu Medical College (Approval No. 2020-127).
Antibody titer was measured using an indirect enzyme-linked immunosorbent assay (ELISA). The PE_PGRS45 protein (5 μg/ml) was coated on a 96-well microplate with 100 μl/well, overnight at 4°C. The coating solution was discarded and the plate was washed with PBS-Tween buffer (0.05% Tween 20 in PBS). The coated wells were blocked with 3% BSA for 1 h at 37°C. Then, the anti-PE_PGRS45 polyclonal antibody was diluted to 0.12 μg/ml, starting with 1:1000, then double-fold dilution, at 100 μl/well. This was incubated at 37°C for 1 h, and then incubated with added blocking solution, and blocked at 37°C for 1 h. The blocking solution was discarded and the plate was washed with PBST. Then, 1:5000 dilution of HRP-labeled goat anti-rabbit IgG (100 μl/well) was added and incubated at 37°C for 1 h. Finally, TMB coloring solution was added (100 μl/well), 37°C, protected from light for 15 min, and the A450 nm value was detected using a microplate reader.
Results
Sequence Analysis of PE_PGRS45
-
Figure 1. The multiple sequence alignment of PE_PGRS45 and its orthologs.
Multiple sequence alignment between
M. tuberculosis PE_PGRS45 and its homologs was performed using BLAST.
Synthesis of the Codon-Optimized PE_PGRS45 Gene
The codon optimization of the gene sequence has a significant influence on the translation rate and overall protein production yield [15, 16]. Therefore, we investigated the codon usage of the PE_PGRS45 gene using
-
Figure 2. Analyses of codon usage in the original PE_PGRS45 gene encoding the PE_PGRS45 protein.
The red bars present the rare codon with a frequency below 5% in
E. coli and the red arrows present the tandem or triple repeats of rare codons.
Construction of PE_PGRS45 Expression Plasmids
An exogenous gene constructed in different expression vectors and expressed in different conditions might result in disparate expression levels and distinctly different protein stabilities for the target protein [18, 19]. We thus constructed three PE_PGRS45 recombinants with varying tags of fusion to screen the optimal recombinant for expressing the target protein. The PE_PGRS45 gene was then cloned into pET-28a, pET-32a, and pMAL-c5x vectors, respectively. The restriction analysis of pET-28a-PE_PGRS45 and pET-32a-PE_PGRS45 plasmids using NcoI and XhoI released the PE_PGRS45 insert of 1,386 bp (Figs. 3A, 3B), and pMAL-c5x-PE_PGRS45 plasmid using NdeI and HindIII individually showed bands at 1,386 bp (Fig. 3C), which confirmed successful cloning of the PE_PGRS45 gene into pET-28a, pET-32a, and pMAL-c5x vectors. The sequencing results complied with the codon-optimized sequence of the synthetic PE_PGRS45 gene and confirmed that the nucleotide sequence of the inserted fragments is correct.
-
Figure 3. Identification of recombinant plasmid.
(A) Plasmid pET-28a-PE_PGRS45 digested by NcoI/XhoI. Lane M: DNA marker; lane 1: plasmid pET-28a-PE_PGRS45 digested by NcoI/XhoI. (B) Plasmid pET-32a-PE_PGRS45 digested by NcoI/XhoI. Lane M: DNA marker; lane 1: plasmid pET-32a-PE_PGRS45 digested by NcoI/XhoI. (C) Plasmid pMAL-c5x- PE_PGRS45 digested by NdeI/HindIII. Lane M: DNA marker; lane 1: plasmid pMAL-c5x-PE_PGRS45 digested by NdeI/ HindIII.
Small-Scale Expression and Solubility Testing
The PE_PGRS45 recombinant protein was produced in
-
Figure 4. SDS-PAGE analysis of expression of PE_PGRS45 recombinant protein by pET-28a and pET-32a expression vectors after PE_PGRS45 codon optimization.
Fusion expression of pET-28a-PE_PGRS45 in
E. coli Arctic Express (DE3) at 20°C (A) and 37°C (B). Fusion expression of pET-32a-PE_PGRS45 inE. coli Arctic Express (DE3) at 20°C (C) and 37°C (D). Lane M, Protein marker; lane 1,E. coli cells before induction; lane 2,E. coli cells after induction; lane 3, supernatant of lysate; lane 4, precipitant of lysate.
-
Figure 5. SDS-PAGE analysis of expression of PE_PGRS45 recombinant protein by pMAL-c5x expression vectors after PE_PGRS45 codon optimization.
Fusion expression of pMAL-c5x-PE_PGRS45 in
E. coli Arctic Express (DE3) at 20°C (A) and 37°C (B). Lane M, Protein marker; lane 1,E. coli cells before induction; lane 2,E. coli cells after induction; lane 3, supernatant of lysate; lane 4, precipitant of lysate.
Purification of Recombinant MBP-PE_PGRS45 Protein
The MBP fusion construct shows high PE_PGRS45 expression levels and solubility. The filtered supernatant was accomplished by immobilized metal affinity chromatography (IMAC) on a Ni-NTA resin column to obtain MBP-PE_PGRS45. The final purity was estimated to be greater than 90% by optic densitometry of the SDS-PAGE gels (Fig. 6).
-
Figure 6. SDS-PAGE analysis of the purified recombinant PE_PGRS45 protein. Lane M, Protein marker; lane 1, Flow fluid; lane 2, Purified PE_PGRS45.
Separation of the PE_PGRS45 Proteins from the MBP Fusion Proteins by Factor Xa Digestion
The pMAL-c5x expression vector contained factor Xa cleavage site (Ile-Glu-Gly-Arg) between the fusion partner (MBP) and the target proteins. To examine whether the MBP fusion protein could be cleaved off from the MBP-PE_PGRS45 proteins, purified MBP-PE_PGRS45 proteins were incubated with factor Xa. SDS-PAGE analysis of the factor Xa digestion showed a complete disappearance of the 82 kDa MBP-PE_PGRS45 proteins after 36 h of incubation along with an appearance of two major bands of around 43 kDa and 39 kDa (Fig. 7), indicating a cleavage of rMBP-PE_PGRS45 proteins into MBP (43 kDa) and PE_PGRS45 proteins (39 kDa).
-
Figure 7. SDS-PAGE analysis of factor-Xa cleaved MBP-PE_PGRS45.
Lane M, Protein marker; lane 1, MBP tag (43 kDa) cleaved using the factor-Xa; lane 2, Final purified PE_PGRS45 (39 kDa).
-
Table 1 . Primers used for the construction of recombinant plasmids..
Expression vector Primer name Primer sequence (5′-3′)a Restriction site pET28a 28aFP CATG CCATGG ATGAGCTTTGTGAATGTGGCCNco I 28aRP CCG CTCGAG TTAACCATCGGCACCGTTGGTACCXho I pET32a 32aFP CATG CCATGG ATGAGCTTTGTGAATGTGGCCNco I 32aRP CCG CTCGAG TTAACCATCGGCACCGTTGGTACCXho I pMAL-c5x c5xFP GGAATT CATATG AGCTTTGTGAATGTGGCCNde I c5xRP CCC AAGCTT TTAACCATCGGCACCGTTGGTACCHind III aThe single underlined sequences indicate restriction enzyme sites..
Antiserum Titer Determination by ELISA
After the rabbits were immunized four times with the purified PE_PGRS45 (Fig. 8A), the antisera were tested at different dilutions from 1:1000 to 1:1024000 by ELISA. As shown in Fig. 8B, the absorbance value ratio of antiserum to negative serum is 2.27 when the ratio is 1:256000. Therefore, the maximum titer of the antiserum was determined to be 1:256000.
-
Figure 8. The process of rabbit immunization (A) and indirect ELISA determined titer of anti-PE_PGRS45 polyclonal antibody (B).
Discussion
PE_PGRS45 is a 461-amino acid protein that shows a very high similarity with the N-terminal domain of PE_PGRS17 and PE_PGRS18. However, a substantial variation is observed between the amino acid sequences in the PGRS domain [13]. Corresponding verification was carried out with our prepared PE_PGRS45 antibody, and some interesting results were also obtained, but further verification is needed (Figs. S1-S3). Strong M
In the present study, His6, Trx, His6-MBP were used as fusion tags, but only MBP-PE_PGRS45 formed soluble expression. The purification using His6-MBP tag-specific binding to the Ni column is also easy to separate after the tag cleavage. Removal of the MBP fusion protein by factor-Xa cleavage did not alter the solubility of PE_PGRS45, supporting that PE_PGRS45 was properly folded and fusion protein with good purity was obtained. We used the purified PE_PGRS45 protein to immunize New Zealand rabbits and got anti-PE_PGRS45 serum. The titer was found to be higher than 1:256000. This shows that the purified PE_PGRS45 protein can induce New Zealand rabbits to produce high-titer antibodies. Therefore, the results of this study lay the basis for the further resolution of the crystal structure of PE_PGRS45, as well as the study of potential function. In addition, this will be followed by further evaluation of these specific antigens to develop highly sensitive and specific diagnostic tests for tuberculosis.
Supplemental Materials
Acknowledgments
This work was supported by Anhui Provincial Natural Science Foundation (1908085MH252, 2008085QH405), Anhui Provincial Natural Science Research Project of University (KJ2018A0233), and 512 Talent Cultivation Plan of Bengbu Medical College (by51201309).
Conflicts of Interest
The authors have no financial conflicts of interest to declare.
Fig 1.
Fig 2.
Fig 3.
Fig 4.
Fig 5.
Fig 6.
Fig 7.
Fig 8.
-
Table 1 . Primers used for the construction of recombinant plasmids..
Expression vector Primer name Primer sequence (5′-3′)a Restriction site pET28a 28aFP CATG CCATGG ATGAGCTTTGTGAATGTGGCCNco I 28aRP CCG CTCGAG TTAACCATCGGCACCGTTGGTACCXho I pET32a 32aFP CATG CCATGG ATGAGCTTTGTGAATGTGGCCNco I 32aRP CCG CTCGAG TTAACCATCGGCACCGTTGGTACCXho I pMAL-c5x c5xFP GGAATT CATATG AGCTTTGTGAATGTGGCCNde I c5xRP CCC AAGCTT TTAACCATCGGCACCGTTGGTACCHind III aThe single underlined sequences indicate restriction enzyme sites..
References
- Qian J, Chen R, Wang H, Zhang X. 2020. Role of the PE/PPE family in host-pathogen interactions and prospects for anti-tuberculosis vaccine and diagnostic tool design.
Front. Cell Infect. Microbiol. 10 : 594288. - Wang Y, Li Z, Wu S, Fleming J, Li C, Zhu G,
et al . 2021. Systematic evaluation ofMycobacterium tuberculosis proteins for antigenic properties identifies Rv1485 and Rv1705c as potential protective subunit vaccine candidates.Infect. Immun. 89 : e00585-20. - Global tuberculosis Report 2020. WHO. https://apps.who.int/iris/handle/10665/336069.
- Glaziou P. 2020. Predicted impact of the COVID-19 pandemic on global tuberculosis deaths in 2020.
medRxiv : 2020.04.28.20079582. - Cole ST, Brosch R, Parkhill J, Garnier T, Churcher C, Harris D,
et al . 1998. Deciphering the biology ofMycobacterium tuberculosis from the complete genome sequence.Nature 393 : 537-544. - Deng W, Xie J. 2012. Ins and outs of
Mycobacterium tuberculosis PPE family in pathogenesis and implications for novel measures against tuberculosis.J. Cell. Biochem. 113 : 1087-95. - De Maio F, Berisio R, Manganelli R, Delogu G. 2020. PE_PGRS proteins of
Mycobacterium tuberculosis : a specialized molecular task force at the forefront of host-pathogen interaction.Virulence 11 : 898-915. - Bottai D, Brosch R. 2009. Mycobacterial PE, PPE and ESX clusters: novel insights into the secretion of these most unusual protein families.
Mol. Microbiol. 73 : 325-328. - Cohen I, Parada C, Acosta-Gío E, Espitia C. 2014. The PGRS domain from PE_PGRS33 of
Mycobacterium tuberculosis is target of humoral immune response in mice and humans.Front. Immunol. 5 : 236. - De Maio F, Maulucci G, Minerva M, Anoosheh S, Palucci I, Iantomasi R,
et al . 2014. Impact of protein domains on PE_PGRS30 polar localization in Mycobacteria.PLoS One 9 : e112482. - Yang W, Deng W, Zeng J, Ren S, Ali MK, Gu Y,
et al . 2017.Mycobacterium tuberculosis PE_PGRS18 enhances the intracellular survival ofM. smegmatis via altering host macrophage cytokine profiling and attenuating the cell apoptosis.Apoptosis 22 : 502-509. - Deng W, Long Q, Zeng J, Li P, Yang W, Chen X,
et al . 2017.Mycobacterium tuberculosis PE_PGRS41 enhances the intracellular survival ofM. smegmatis within macrophages via blocking innate immunity and inhibition of host defense.Sci. Rep. 7 : 46716. - Karboul A, Gey van Pittius NC, Namouchi A, Vincent V, Sola C,
et al . 2006. Insights into the evolutionary history of tubercle bacilli as disclosed by genetic rearrangements within a PE_PGRS duplicated gene pair.BMC. Evol. Biol. 6 : 107. - Bachhawat N. 2018. PE-only/PE_PGRS proteins of
Mycobacterium tuberculosis contain a conserved tetra-peptide sequence DEVS/DXXS that is a potential caspase-3 cleavage motif.J. Biosci. 43 : 597-604. - Ermolaeva MD. 2001. Synonymous codon usage in bacteria.
Curr. Issues Mol. Biol. 3 : 91-97. - Sørensen MA, Kurland CG. 1989. Pedersen S. Codon usage determines translation rate in
Escherichia coli .J. Mol. Biol. 207 : 365-377. - Kopke K, Hoff B, Kück U. 2010. Application of the
Saccharomyces cerevisiae FLP/FRT recombination system in filamentous fungi for marker recycling and construction of knockout strains devoid of heterologous genes.Appl. Environ. Microbiol. 76 : 4664-4674. - Jhamb K, Sahoo DK. 2012. Production of soluble recombinant proteins in
Escherichia coli : effects of process conditions and chaperone co-expression on cell growth and production of xylanase.Bioresour. Technol. 123 : 135-143. - Tian S, Chen H, Sun T, Wang H, Zhang X, Liu Y,
et al . 2016. Expression, purification and characterization of Esx-1 secretionassociated protein EspL fromMycobacterium tuberculosis .Protein Expr. Purif. 128 : 42-51. - Yu X, Feng J, Huang L, Gao H, Liu J, Bai S,
et al . 2019. Molecular basis underlying host immunity subversion byMycobacterium tuberculosis PE/PPE family molecules.DNA. Cell Biol. 38 : 1178-1187. - Dheenadhayalan V, Delogu G, Sanguinetti M, Fadda G, Brennan MJ. 2006. Variable expression patterns of
Mycobacterium tuberculosis PE_PGRS genes: evidence that PE_PGRS16 and PE_PGRS26 are inversely regulated in vivo.J. Bacteriol. 188 : 3721-3725. - Srivastava V, Jain A, Srivastava BS, Srivastava R. 2008. Selection of genes of
Mycobacterium tuberculosis upregulated during residence in lungs of infected mice.Tuberculosis (Edinb) 88 : 171-177. - Strong M, Sawaya MR, Wang S, Phillips M, Cascio D, Eisenberg D. 2006. Toward the structural genomics of complexes: crystal structure of a PE/PPE protein complex from
Mycobacterium tuberculosis .Proc. Natl. Acad. Sci. USA 103 : 8060-8065. - Kaur J, Kumar A, Kaur J. 2018. Strategies for optimization of heterologous protein expression in
E. coli : Roadblocks and reinforcements.Int. J. Biol. Macromol. 106 : 803-822. - Young CL, Britton ZT, Robinson AS. 2012. Recombinant protein expression and purification: a comprehensive review of affinity tags and microbial applications.
Biotechnol. J. 7 : 620-634. - Arnau J, Lauritzen C, Petersen GE, Pedersen J. 2006. Current strategies for the use of affinity tags and tag removal for the purification of recombinant proteins.
Protein. Expr. Purif. 48 : 1-13. - Kosobokova EN, Skrypnik KA, Kosorukov VS. 2016. Overview of fusion tags for recombinant proteins.
Biochemistry (Mosc) 81 : 187-200. - Bach H, Mazor Y, Shaky S, Shoham-Lev A, Berdichevsky Y, Gutnick DL,
et al . 2001.Escherichia coli maltose-binding protein as a molecular chaperone for recombinant intracellular cytoplasmic single-chain antibodies.J. Mol. Biol. 312 : 79-93. - Park C, Zhou S, Gilmore J. 2007. Marqusee S: Energetics-based protein profiling on a proteomic scale: identification of proteins resistant to proteolysis.
J. Mol. Biol. 368 : 1426-1437. - Sun P, Tropea JE, Waugh, DS. 2011. Enhancing the solubility of recombinant proteins in
Escherichia coli by using hexahistidinetagged maltose-binding protein as a fusion partner.Methods Mol. Biol. 705 : 259-274. - Lee SB, Choi R, Park SK, Kim YS. 2014. Production of bioactive chicken follistatin315 in
Escherichia coli .Appl. Microbiol. Biotechnol. 98 : 10041-10051.