전체메뉴
검색
Article Search

JMB Journal of Microbiolog and Biotechnology

QR Code QR Code

Research article

References

  1. Koo O, Lee S, Chung K, Jang D, Yang H. 2016. Korean traditional fermented fish products: jeotgal. J. Ethn. Foods 3: 107-116.
    CrossRef
  2. Marui J, Boulom S, Panthavee W, Momma M, Kusumoto K, Nakahara K, et al. 2015. Culture-independent bacterial community analysis of the salty-fermented fish paste products of Thailand and Laos. Biosci. Microbiota Food Health 34: 45-52.
    Pubmed PMC CrossRef
  3. Choi DK. 2012. The appearance of salted seafood in the east Asia and Vietnam's nuoc mam - focusing on the origin and popularization of fermented sea foods in Korea and in Vietnam. Asian Comp. Folklore 48: 201-246.
  4. Guan L, Cho KH, Lee JH. 2011. Analysis of the cultivable bacterial community in jeotgal, a Korean salted and fermented seafood, and identification of its dominant bacteria. Food Microbiol. 28: 101-113.
    Pubmed CrossRef
  5. Ahmadsah LSF, Kim E, Jung YS, Kim HY. 2018. Identification by PCR-DGGE, SDS-PAGE, and MALDI-TOF MS of LAB and fungi in laru, a fermented starter. J. Microbiol. Biotechnol. 28: 32-39.
    CrossRef
  6. Cho Y, Kim E, Lee Y, Han SK, Choo DW, Kim YR, et al. 2017. Rapid and accurate identification of Pediococcus species isolated from Korean fermented foods by MALDITOF MS with local database extension. Int. J. Syst. Evol. Microbiol. 67: 744-752.
    CrossRef
  7. Kim E, Cho Y, Lee Y, Han SK, Kim CG, Choo DW, et al. 2017. A proteomic approach for rapid identification of Weissella species isolated from Korean fermented foods on MALDI-TOF MS supplemented with an in-house database. Int. J. Food Microbiol. 243: 9-15.
    Pubmed CrossRef
  8. Kim MS, Park EJ. 2014. Bacterial communities of traditional salted and fermented seafoods from Jeju Island of Korea using 16S rRNA gene clone library analysis. J. Food Sci. 79: M927-M934.
    Pubmed CrossRef
  9. Han S, Hong Y, Kwak H, Kim E, Kim M, Shrivastav A, et al. 2014. Identification of lactic acid bacteria in pork meat and pork meat products using SDS-PAGE, 16S rRNA gene sequencing and MALDI-TOF mass spectrometry. J. Food Saf. 34: 224-232.
    CrossRef
  10. Nguyen DT, Van Hoorde K, Cnockaert M, De Brandt E, Aerts M, Binh Thanh L, et al. 2013. A description of the lactic acid bacteria microbiota associated with the production of traditional fermented vegetables in Vietnam. Int. J. Food Microbiol. 163: 19-27.
    Pubmed CrossRef
  11. Doan NT, Van Hoorde K, Cnockaert M, De Brandt E, Aerts M, Le Thanh B, et al. 2012. Validation of MALDI-TOF MS for rapid classification and identification of lactic acid bacteria, with a focus on isolates from traditional fermented foods in Northern Vietnam. Lett. Appl. Microbiol. 55: 265-273.
    Pubmed CrossRef
  12. Hong Y, Li J, Qin P, Lee SY, Kim HY. 2015. Predominant lactic acid bacteria in mukeunji, a long-term-aged kimchi, for different aging periods. Food Sci. Biotechnol. 24: 545-550.
    CrossRef
  13. Angelakis E, Million M, Henry M, Raoult D. 2011. Rapid and accurate bacterial identification in probiotics and yoghurts by MALDI-TOF mass spectrometry. J. Food Sci. 76: M568-M572.
    Pubmed CrossRef
  14. Lee SH, Jung JY, Jeon CO. 2014. Effects of temperature on microbial succession and metabolite change during saeu-jeot fermentation. Food Microbiol. 38: 16-25.
    Pubmed CrossRef
  15. Hong Y, Yang HS, Li J, Han SK, Chang HC, Kim HY. 2014. Identification of lactic acid bacteria in salted Chinese cabbage by SDS-PAGE and PCR-DGGE. J. Sci. Food Agric. 94: 296-300.
    Pubmed CrossRef
  16. Han KI, Kim YH, Hwang SG, Jung EG, Patnaik BB, Han YS, et al. 2014. Bacterial community dynamics of salted and fermented shrimp based on denaturing gradient gel electrophoresis. J. Food Sci. 79: M2516-M2522.
    Pubmed CrossRef
  17. Roh SW, Kim KH, Nam YD, Chang HW, Park EJ, Bae JW. 2010. Investigation of archaeal and bacterial diversity in fermented seafood using barcoded pyrosequencing. ISME J. 4: 1-16.
    Pubmed CrossRef
  18. Kim TW, Lee JH, Park MH, Kim HY. 2010. Analysis of bacterial and fungal communities in Japanese- and Chinesefermented soybean pastes using nested PCR-DGGE. Curr. Microbiol. 60: 315-320.
    Pubmed CrossRef
  19. Udomsil N, Rodtong S, Choi YJ, Hua Y, Yongsawatdigul J. 2011. Use of Tetragenococcus halophilus as a starter culture for flavor improvement in fish sauce fermentation. J. Agric. Food Chem. 59: 8401-8408.
    Pubmed CrossRef
  20. Collins MD, Williams AM, Wallbanks S. 1990. The phylogeny of Aerococcus and Pediococcus as determined by 16S rRNA sequence analysis: description of Tetragenococcus gen. nov. FEMS Microbiol. Lett. 58: 255-262.
    Pubmed CrossRef
  21. Masuda S, Yamaguchi H, Kurokawa T, Shirakami T, Tsuji RF, Nishimura I. 2008. Immunomodulatory effect of halophilic lactic acid bacterium Tetragenococcus halophilus Th221 from soy sauce moromi grown in high-salt medium. Int. J. Food Microbiol. 121: 245-252.
    Pubmed CrossRef
  22. Lee H, Choi Y, Hwang I, Hong S, Lee M. 2016. Relationship between chemical characteristics and bacterial community of a Korean salted-fermented anchovy sauce, Myeolchi-Aekjeot. LWT Food Sci. Technol. 73: 251-258.
    CrossRef
  23. Jung JY, Lee SH, Jeon CO. 2014. Kimchi microflora: history, current status, and perspectives for industrial kimchi production. Appl. Microbiol. Biotechnol. 98: 2385-2393.
    Pubmed CrossRef
  24. Kim M, Chun J. 2005. Bacterial community structure in kimchi, a Korean fermented vegetable food, as revealed by 16S rRNA gene analysis. Int. J. Food Microbiol. 103: 91-96.
    Pubmed CrossRef
  25. Lee JS, Heo GY, Lee JW, Oh YJ, Park JA, Park YH, et al. 2005. Analysis of kimchi microflora using denaturing gradient gel electrophoresis. Int. J. Food Microbiol. 102: 143-150.
    Pubmed CrossRef
  26. Park JM, Shin JH, Lee DW, Song JC, Suh HJ, Chang UJ, et al. 2010. Identification of the lactic acid bacteria in kimchi according to initial and over-ripened fermentation using PCR and 16S rRNA gene sequence analysis. Food S ci. Biotechnol. 19: 541-546.
    CrossRef
  27. Cho J, Lee D, Yang C, Jeon J, Kim J, Han H. 2006. Microbial population dynamics of kimchi, a fermented cabbage product. FEMS Microbiol. Lett. 257: 262-267.
    Pubmed CrossRef
  28. Zheng Y, Zheng XW, Han BZ, Han JS, Nout MJR, Chen JY. 2013. Monitoring the ecology of Bacillus during Daqu incubation, a fermentation starter, using culture-dependent and culture-independent methods. J. Microbiol. Biotechnol. 23: 614-622.
    Pubmed CrossRef
  29. Yan YZ, Qian YL, Ji FD, Chen JY, Han BZ. 2013. Microbial composition during Chinese soy sauce koji-making based on culture dependent and independent methods. Food Microbiol. 34: 189-195.
    Pubmed CrossRef

Related articles in JMB

More Related Articles

Article

Research article

J. Microbiol. Biotechnol. 2018; 28(7): 1112-1121

Published online July 28, 2018 https://doi.org/10.4014/jmb.1803.03034

Copyright © The Korean Society for Microbiology and Biotechnology.

Identification of lactic acid bacteria in galchi- and myeolchi-jeotgalby 16S rRNA sequencing, MALDI TOF mass spectrometry, and PCR-DGGE

Yoonju Lee , Youngjae Cho , Eiseul Kim , Hyun-Joong Kim and Hae-Yeong Kim *

Kyung Hee University, Korea

Received: March 27, 2018; Accepted: June 4, 2018

Abstract

Jeotgal is Korean traditional fermented seafood with a high concentration of salt. In this study, we isolatedlactic acid bacteria (LAB)from galchi (Trichiuruslepturus, hairtail) and myeolchi (Engraulis japonicas, anchovy) jeotgal on MRS agar and MRS agar containing 5% NaCl (MRS agar+5% NaCl), followed by identification using 16S rRNA sequencing and matrix-assisted laser desorption ionization time of flight mass spectrometry (MALDI TOF-MS) asculture-dependent methods. We also performedpolymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE)to identify bacterial communities as a culture-independent method. Five samples of galchi-jeotgal and seven samples of myeolchi-jeotgal were collected from different regions in Korea. Total of 327 and 395 colonies were isolatedfrom galchi- and myeolchi-jeotgal samples, respectively. 16S rRNA sequencing and MALDI TOF-MS revealed that the genus Pediococcus was predominant on MRS agar and Tetragenococcushalophilus on MRS agar+5% NaCl. PCR-DGGE revealed that T. halophilus, T. muriaticus, and Lactobacillus sakei were predominant in both types of jeotgal. T. halophiluswas detected in all samples. Even though same species were identified by both culture-dependent and -independent methods, many species identified by culture-dependent methods were not in the bacterial list identified by culture-independent methods.Distribution of bacteria in galchi-jeotgal was more diverse thanin myeolchi-jeotgal.The diverse LAB in galchi- and myeolchi-jeotgalscan be further studied as candidates for starter culturesto produce fermented foods.

Keywords: Lactic acid bacteria, galchi-jeotgal, myeolchi-jeotgal, 16S rRNA sequencing, MALDI TOF-MS, PCR-DGGE

Introduction

Jeotgal or jeot is traditional fermented and salted seafood widely consumed in regions that have rice-based diets, such as Korea, Japan, and Southeast Asia. This food product is manufactured by adding salt to various types of seafood to prevent spoilage and has a distinctive flavor as a result of enzymatic reactions among the ingredients. The various types of Korean traditional fermented and salted seafood, such as jeotgal, aekjeot (fish sauce), and sikhae (fermented fish with grains) are distinguished by the manufacturing process. In Korea, jeotgal is made using diverse raw materials, including whole meat, intestines, or eggs of fish and shellfish. There are approximately 150 different kinds of jeotgal in Korea that differ by main ingredient and/or processing method [1]. Jeotgal is also made in other countries; it is known as pla-ra and pa-daek in Thailand and Laos [2], and nuoc-man in Vietnam [3]. Jeotgal is made by adding salt to a final concentration of a 20-30% to the raw material and allowing the mixture to ferment for 2-3 months [1]. Jeotgal is used as an important condiment in kimchi or for seasoning Korean-style stews to enhance flavor and taste. Additionally, the bacterial communities in jeotgal are thought to improve appetite and digestion [1].

In general, most bacteria in jeotgal originate from the seafood used as the main ingredient or the environment of that seafood. Owing to the high salt concentration of jeotgal, halophilic or halotolerant bacteria can survive and participate in the fermentation, whereas the growth of harmful bacteria is decreased [1]. Examples of bacterial genera present in jeotgal include Halobacterium and Halomonas in addition to Bacillus, Brevibacterium, Flavobacterium, Micrococcus, Pediococcus, Pseudomonas, and Staphylococcus [1]. The bacterial communities vary according to the ingredients and fermentation period. There has been extensive research into the bacteria present in jeotgal because they contribute to its fermentation and ripening. However, few studies have reported the lactic acid bacteria (LAB) communities present in jeotgal and their functions in the fermentation process [4]. This is mostly because LAB cannot survive in the high salt environment of jeotgal. In this study, we identified LAB communities present in different jeotgal samples using agars containing salt.

Tools to investigate bacterial community composition can be categorized as culture-dependent or -independent. Culture-dependent methods rely on the application of molecular techniques such as 16S rRNA gene sequencing and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify isolates from cultured media [5-7]. 16S rRNA gene sequencing is one of the most commonly used techniques for bacterial identification [4, 8]. However, this technique is time-consuming because genes from extracted DNA need to be amplified by the polymerase chain reaction (PCR) and be purified for sequencing. In contrast, MALDI-TOF MS is an effective and accurate identification technique that can be performed in a short time period using only a single colony, and a large number of isolates can be analyzed simultaneously [9, 10]. This quick and accurate technique has previously been used to characterize bacterial communities in diverse fermented foods from various countries, including fermented meat nem chua from Vietnam [11] and vegetable dua muoi and ca muoi [10], including mukeunji, a long-term aged kimchi [12], as well as yogurt and probiotics [13]. Nevertheless, few studies have used MALDI-TOF MS analysis to identify bacterial communities in jeotgal.

Although the distribution of viable cells in each sample can be determined and isolates acquired through culture-dependent methods, bacteria present at very low levels or dead bacteria cannot be cultured [14]. These hard-to-culture microorganisms can be detected effectively by culture-independent methods [15]. One conventional culture-independent method is polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE). Genomic DNA extracted directly from each sample is separated by the GC content of the DNA, with different bacteria showing specific band patterns in the gradient gel after electrophoresis. This method has been used to detect diverse bacterial communities grown in culture as well as organisms that cannot be cultured. PCR-DGGE has been used in several studies to investigate microorganisms in various fermented foods, including jeotgal [2, 15-18]. Among the many kinds of jeotgals made using various seafoods, galchi (hairtail)- and myeolchi (anchovy)-jeotgal are common kimchi ingredients that are widely consumed in Korea.

Our aim in this study was to investigate the bacterial communities, especially LAB, present in galchi- and myeolchi-jeotgals using diverse identification methods. First, the bacterial communities from various jeotgal samples purchased from different regions of South Korea were identified using 16S rRNA gene sequencing and MALDI-TOF MS of isolates grown on agar plates with or without salt as culture-dependent methods. Additionally, the bacterial communities were analyzed using PCR-DGGE as a culture-independent method.

Materials and Methods

Jeotgal Sample Preparation and Measurement of pH and Salinity Five samples of galchi-jeotgal were collected from five markets (Se-1, Se-2, Se-3, So-1, and Y-1) in three regions (Seoul, Sokcho, and Yeosu) and seven samples of myeolchi-jeotgal were purchased from seven markets (B-1, B-2, B-3, Se-1, Se-2, Se-3, and Y-1) in three regions (Busan, Seoul, and Yeosu) in Korea. To measure the pH and salinity of each sample, 1 g of sample and 10 ml of sterilized water were mixed and centrifuged at 16,200 ×g for 10 min. The pH of the collected supernatant was then measured using an Orion star a211 pH meter (Thermo Fisher Scientific, USA) and the salinity was measured using a PAL-03S refractometer (ATAGO, Japan).

Isolation of Lactic Acid Bacteria

Ten grams of each sample was mixed with 90 ml of sterile water in a Stomacher filter bag (Seward Limited, UK) and homogenized using a Stomacher 400 (Seward Limited, UK) for 30 sec at 230 rpm. After serial dilution of the homogenized samples with phosphate-buffered saline, 100 μl of highly diluted sample was spread onto MRS agar (Acumedia, USA) and MRS agar containing 5% NaCl (MRS agar+5% NaCl), and incubated anaerobically for 72 h at 30°C to culture LAB. Single colonies that differed in morphological characteristics were picked from each plate and subcultured in MRS broth (Acumedia, USA) and MRS broth containing 5% NaCl (MRS broth+5% NaCl) for 24 h at 30°C. Enriched bacterial isolates in both broths were mixed with 80%glycerol at the ratio of 7:3 and stored at -80°C.

Comparison of Whole Cell Protein Patterns through SDS-PAGE Analysis

Each isolate was cultured in MRS broth or MRS broth+5% NaCl for 24 h at 30°C and centrifuged at 16,200 ×g, 4°C for 15 min. The collected pellet of each isolate was washed twice with sterile water and mixed with 50 mM (pH 8.0) Tris-HCl buffer. Glass beads (425-600 μm diameter; Sigma, USA) were added to the suspended solution, which was then vortexed for 8 min. The same amount of 2× buffer was added and heated for 5 min in an ALB64 heat block (FINEPCR, Korea). After cooling to room temperature, the supernatant obtained through centrifugation for 5 min was subjected to gel electrophoresis. Samples (5 μl of whole cell protein extract) were electrophoresed on a 30% acrylamide gel run at 100 V for 90 min. After gel electrophoresis, whole cell protein patterns were determined by staining the gel with staining buffer (1.25 g/l Coomassie brilliant blue, 500 ml/l methanol, 900 ml/l acetic acid, and 400 ml/l H2O) for 1 h, followed by destaining with destaining buffer (100 ml/l acetic acid, 300 ml/l methanol, and 600 ml/l H2O) for 3 h. Whole cell protein patterns were analyzed after scanning with a high resolution scanner (Perfection V700 photoscanner; Epson, USA). Each isolate was classified into different groups according to pattern similarities. Representative isolates were selected from each group for bacterial identification.

Identification by 16S rRNA Gene Sequencing

The 16S rRNA gene of representative isolates from each group was sequenced. Genomic DNA extracted using the G-spin Genomic DNA Extraction kit (Intronbio, Korea) was used as the template to amplify the 16S rRNA gene by PCR with 16S universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-GGCTACCTTGTTAGCGACTT-3’). After purifying the amplicons using the QIAquick PCR purification kit (Qiagen, Germany), the amplicons were sequenced using an automated DNA sequencer (Applied Biosystems, USA). The 16S rRNA gene sequences were then analyzed by BLAST searches of the NCBI database.

Identification by MALDI-TOF MS

A single colony of each isolate was spotted directly on a target plate (Bruker Daltonics GmbH, Germany) overlaid with 1 μl of 70% formic acid and air-dried. All spots were overlaid with a matrix solution (Bruker Daltonics GmbH, Germany) of α-cyano-4-hydroxycinnamic acid in 50% acetonitrile and 2.5% trifluoroacetic acid. Each spot was measured using a microflex LT mass spectrometer (Bruker Daltonics GmbH, Germany). Parameters were as follows: ion source 1, 20.0 kV; ion source 2, 18.2 kV; lens, 6.0 kV; initial laser power; 25%; and maximal laser power; 35%. Mass spectra were analyzed using Flexcontrol 3.0 software and the MALDI Biotyper database.

Analysis of Bacterial Communities by PCR-DGGE

Ten grams of each sample was mixed with 90 ml of sterile water in a Stomacher filter bag and homogenized using a Stomacher 400 at 230 rpm for 30 sec. The homogenized samples were filtered through four layers of cheesecloth and centrifuged at 4,250 ×g, at 4°C for 15 min. The collected pellets were washed twice with sterile water, and genomic DNA was extracted using the P&C Bacterial Genomic DNA Extraction kit (Biosolution, Korea). The yield and quality of extracted DNA were analyzed by electrophoresis using a 1% (w/v) agarose gel. Extracted DNA was used as the template for initial PCR targeting the 16S rRNA gene, using the primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-GGCTACCTTGTTAGCGACTT-3’). This amplicon was used as a template for nested PCR to amplify the V3 region of the 16S rRNA gene, using the DGGE primers GC338F (5’-GCCCGC CGCGCGCGGCGGGCGGCGGGGGCACGGGGGGACTCCTAC GGGAGGCAGCAG-3’) and 518R (5’-ATTACCGCGGCTGCTGG-3’). For DGGE analysis, the nested PCR product was applied directly to a denaturing gradient gel containing 20-50% urea (USB, USA)-formamide (Sigma, USA), and electrophoresis was carried out using the DCode system (Bio-Rad, USA) with samples electrophoresed for 40 min at 40 V and then 15 h at 60 V. During electrophoresis, genomic DNA of each sample was separated into diverse bacterial DNAs with different GC contents. The separated DNA was visualized by staining the gel with ethidium bromide for 1 h and imaged using the Quantum ST5 gel documentation system (Vilber Lourmat, Germany). Bands of interest on the gel were excised using sterile blades, washed twice with sterilized water, and incubated overnight at 4°C. During the overnight incubation, bacterial DNA diffused out from the gel. The eluate was then used as a template for re-amplification using the primers GC 338F and 518R. To confirm the presence of a single band and improve the purity, the amplicon was re-run on a DGGE gel. After obtaining a single band on the gel, the eluted DNA was used for amplification of the V3 region of 16S rRNA using the same primer pairs without a GC clamp for sequencing. The PCR products were purified using a QIAquick PCR purification kit and sequenced using an automated DNA sequencer. Partial 16S rRNA gene sequences were compared with the NCBI database using BLAST and closest known relatives were determined.

Results and Discussion

pH and Salinity of Galchi- and Myeolchi-Jeotgals

The jeotgal samples used in this study were collected from four different regions in Korea. Five galchi-jeotgal samples were obtained from Seoul, Sokcho, and Yeosu, and seven myeolchi-jeotgal samples were obtained from Busan, Seoul, and Yeosu. As shown in Table 1, the pH ranges of the galchi- and myeolchi-jeotgal samples were 5.83-6.62 and 5.65-6.17, respectively, and the salinity range was 30-48% and 26-40%, respectively.

Table 1 . Sample information and chemical characterization of the galchi- and myeolchi-jeotgal samples used in this study..

Sample (fish material)RegionaMarketbpHSalinity (%)
Galchi-jeotgalSeoulSe-15.8332
(Hairtail)SeoulSe-25.8933
SeoulSe-35.9848
SokchoSo-16.6230
YeosuY-16.1737
Myeolchi-jeotgalBusanB-15.8933
(Anchovy)BusanB-26.1630
BusanB-36.1726
SeoulSe-15.6540
SeoulSe-26.1534
SeoulSe-35.9836
YeosuY-15.6636

aSamples were purchased from four different regions of Korea: Busan, Seoul, Sokcho, and Yeosu..

bMarkets in each region are abbreviated as follows: Busan: B; Seoul: Se; Sokcho: So; and Yeosu: Y..



Grouping of Jeotgal Isolates by SDS-PAGE Whole Cell Protein Patterns

A total of 327 isolates, comprising 139 and 188 colonies from the galchi-jeotgal samples, were collected on MRS agar and MRS agar+5% NaCl, respectively, whereas 395 colonies, comprising 170 and 225 isolates from the myeolchi-jeotgal samples, were isolated on MRS agar and MRS agar+5% NaCl agar, respectively. These isolates were subjected to SDS-PAGE to observe whole cell protein patterns. Galchi-jeotgal isolates grown on MRS agar and MRS agar+5% NaCl could be differentiated into 8 and 7 groups, respectively, whereas myeolchi-jeotgal isolates grown on both agars could be differentiated into 8 and 9 groups, respectively, based on these whole cell protein patterns (Fig. S1).

Identification of Jeotgal Isolates by 16S rRNA gene sequencing

Based on the whole cell protein patterns, two isolates from each protein pattern group were randomly selected and identified using 16S rRNA gene sequencing. These two isolates were confirmed to be the same species in all cases. Galchi-jeotgal isolates in the eight groups grown on MRS agar were identified as six LAB, whereas those in the seven groups grown on MRS agar+5% NaCl were identified as four LAB and one non-LAB (Table 2). The galchi-jeotgal samples showed a more diverse community of LAB when isolates were grown on MRS agar than when grown on MRS agar+5% NaCl. On MRS agar, Pediococcus acidilactici (71 isolates, 51.1%) was predominant, followed by Pediococcus pentosaceus (36 isolates, 25.9%), whereas Tetragenococcus halophilus (105 isolates, 55.9%) was predominant on MRS agar+5% NaCl. Among all galchi-jeotgal isolates, P. acidilactici, P. pentosaceus, and Leuconostoc mesenteroides were detected in both agars. In contrast, Enterococcus devriesei, Enterococcus faecium, and Weissella viridescens were isolated only on MRS agar, whereas T. halophilus and Staphylococcus epidermidis were isolated only on MRS agar+5% NaCl. Among the myeolchi-jeotgal isolates that grew on MRS agar, four LAB and one non-LAB were identified from the eight differentiated protein groups (Table 2). A total of six LAB were identified from the nine groups of myeolchi-jeotgal isolates that grew on MRS agar+5% NaCl.

Table 2 . Isolates identified from galchi- and myeolchi-jeotgal samples by 16S rRNA gene sequencing and MALDI-TOF MS..

SampleConcentration of NaCl in MRS agara16S rRNA sequencing (NCBI Accession No.)Similarity (%)2)MALDI-TOF MSScore valuecRatio of distribution (%)dMarket (no. of isolates)
Galchi-jeotgal0%Enterococcus devriesei (GQ337023.1)100Enterococcus devriesei DSM 22802T1.71510.072Se-1 (14)
Enterococcus faecium (CP011828.1)100Enterococcus faecium 110372.3790.719Se-2 (1)
Leuconostoc mesenteroides (KP764082.1)100Leuconostoc mesenteroides ssp. mesenteroides DSM20343T2.20110.792Se-3 (15)
Pediococcus acidilactici (KT275957.1)100Pediococcus acidilactici KCTC31012.61951.079So-1 (21), Y-1 (50)
Pediococcus pentosaceus (KR010991.1)100Pediococcus pentosaceus DSM 202062.02915.108Se-2 (21)
Pediococcus pentosaceus (KT327865.1)100Pediococcus pentosaceus DSM 202062.31910.791So-1 (15)
Weissella viridescens (LC065637.1)100Weissella viridescens DSM 20410T1.8781.439Se-2 (2)
Sub-total100.000139
5%Leuconostoc mesenteroides (KP764082.1)100Leuconostoc mesenteroides ssp. mesenteroides DSM20343T2.0207.447Se-3 (14)
Pediococcus acidilactici (AP012046.1)100Pediococcus acidilactici KCTC31012.70213.830So-1 (26)
Pediococcus pentosaceus (KR010991.1)100Pediococcus pentosaceus DSM 202061.8099.043Se-2 (17)
Staphylococcus epidermidis (KT427443.1)100Staphylococcus epidermidis DSM 32692.17313.830Se-3 (26)
Tetragenococcus halophilus (AP012046.1)100Tetragenococcus halophilus ATCC 333152.17113.298Y-1 (25)
Tetragenococcus halophilus (KJ699138.1)100Tetragenococcus halophilus ATCC 333152.24217.552Se-2 (33)
Tetragenococcus halophilus (LC071840.1)100Tetragenococcus halophilus ATCC 333152.17125.000Se-1 (47)
Sub-total100.000188
Total327
Myeolchi-jeotgal0%Lactobacillus sakei (KJ026631.1)100Lactobacillus sakei ssp. carnosus DSM 157402.19314.706Se-1 (25)
Lactobacillus sakei (KT327858.1)100Lactobacillus sakei DSM 201012.2081.176B-1 (2)
Leuconostoc mesenteroides (KP764082.1)100Leuconostoc mesenteroides ssp. mesenteroides DSM20343T2.166.471Se-3 (11)
Pediococcus pentosaceus (KP723364.1)100Pediococcus pentosaceus DSM 202062.11732.353B-1 (26), B-2 (29)
Pediococcus pentosaceus (KT757261.1)100Pediococcus pentosaceus KCTC35072.18218.235Se-2 (31)
Staphylococcus epidermidis (KJ571206.1)100Staphylococcus epidermidis DSM 48512.20811.765B-3 (20)
Tetragenococcus halophilus (NR075020.1)100Tetragenococcus halophilus ATCC 333152.02115.294Y-1 (26)
Sub-total100.000170
5%Lactobacillus curvatus (LC063167.1)100Lactobacillus curvatus DSM 204951.37513.333Se-2 (30)
Lactobacillus sakei (KT327858.1)100Lactobacillus sakei ssp. carnosus DSM 15831T2.23817.778B-3 (40)
Leuconostoc mesenteroides (KP764082.1)100Leuconostoc mesenteroides ssp. cremoris DSM 20346T2.16810.222Se-3 (23)
Pediococcus pentosaceus (KT327865.1)100Pediococcus pentosaceus DSM 202062.02012.889B-2 (29)
Tetragenococcus halophilus (KC170304.1)100Tetragenococcus halophilus ATCC 333152.0214.444Se-1 (10)
Tetragenococcus halophilus (KJ699143.1)100Tetragenococcus halophilus ATCC 333152.0335.333Se-3 (12)
Tetragenococcus halophilus (KP8452871)100Tetragenococcus halophilus ATCC 333152.34812.444Se-2 (28)
Tetragenococcus halophilus (NR075020.1)100Tetragenococcus halophilus ATCC 333152.11011.111Y-1 (25)
Weissella halotolerans (LC064886.1)100Weissella halotolerans DSM 20190T2.00412.444B-1 (28)
Sub-total100.000225
Total395

aTotal concentration of NaCl added to MRS agar..

bSimilarities of the 16S rRNA gene of identified strains to those present in the NCBI sequence database..

cLog score values were obtained as follows: ≥2.000: species-level identification; 1.700-1.999: genus-level identification; ≤1.699: not reliably identified..

dRatio of distribution (%) = number of isolates / total number of isolates × 100..



Among the isolates from myeolchi-jeotgal, P. pentosaceus (86 isolates, 50.6%) and T. halophilus (75 isolates, 33.3%) were predominant on MRS agar and MRS agar+5% NaCl, respectively. In addition, Lactobacillus sakei, L. mesenteroides, P. pentosaceus, and T. halophilus were isolated from both agars. Staphylococcus epidermidis was isolated only on MRS agar whereas Lactobacillus curvatus and Weissella halotolerans were isolated only on MRS agar+5% NaCl. The genus Pediococcus was isolated from both types of jeotgal and was the predominant isolate on MRS agar.

A previous study demonstrated that some Pediococcus species play an important role in fermentation and ripening of fermented foods [4]. Another study also reported that P. acidilactici from galchi-jeotgal was the predominant isolate on MRS agar and reduced the amount of histamine, a biogenic amine produced during the fermentation period [19]. The genus Tetragenococcus was isolated from both types of jeotgal when isolates were grown on MRS agar+5% NaCl. T. halophilus was known as P. halophilus in the past, but was reclassified to the genus Tetragenococcus on the basis of 16S rRNA gene sequencing [20]. T. halophilus is an important starter culture for fish sauce because this species not only increases the flavor and taste of fish sauce by producing various volatile compounds and amino acids as a result of proteolytic activity, but also reduces the amount of histamine during fermentation [19]. Additionally, T. halophilus has immune regulatory functions [21]. In a previous study, species in the genus Tetragenococcus, namely T. halophilus and T. muriaticus, were the predominant isolates from fermented seafood including myeolchi [4, 8, 22] and jaridom (Chromis notatus) [8]. Tetragenococcus has also been found in pla-ra and pa-daek, which are traditionally fermented seafood produced in Thailand and Laos [2]. Previous research demonstrated that Tetragenococcus could only be cultured in media containing salt [4]. Tetragenococcus exhibits maximum growth at high salt concentrations (up to 20%) in the pH range from 5 to 6 [2, 4, 8, 22]. Consequently, some species of Tetragenococcus that have strong halophilic characteristics can be important for fermentation in galchi-and myeolchi-jeotgals.

Identification of Jeotgal Isolates by MALDI-TOF MS

Results of bacterial identification based on MALDI-TOF MS are shown in Table 2. Among the 30 representative isolates, 26 (86.7%) were identified to the species level (log score ≥ 2.0), whereas three (10.0%) were identified to the genus level (log score between 2.0 and 1.7). Exceptionally, only a single representative isolate (3.3%) of Se-2, representing Lactobacillus curvatus DSM 20495, had an unacceptable score value (1.375) and this was assumed to be caused by the limited reference strains available in the MALDI-TOF MS database [20]. Owing to the lack of Pediococcus and Tetragenococcus reference strains in the MALDI Biotyper database, we established a local database using three reference strains (Pediococcus acidilactici KCTC3101, Pediococcus pentosaceus KCTC3507, and Tetragenococcus halophilus ATCC 33315). Using this database, most Pediococcus and Tetragenococcus strains were identified with high score values.

All isolates identified using MALDI-TOF MS were consistent with those identified using 16S rRNA gene sequencing. Based on 16S rRNA gene sequencing, the representative strain of Se-1 isolated from galchi-jeotgal isolates that grew on MRS agar was identified as three species of Enterococcus (E. avium, E. devriesei, and E. gilvus), and the representative strain of B-3 isolated from myeolchi-jeotgal grown on MRS agar was identified as two species of Staphylococcus (S. epidermidis and S. captis). Those isolates were identified as E. devriesei and S. epidermidis on MALDI-TOF MS. In the bacterial communities present in galchi-and myeolchi-jeotgals identified through MALDI-TOF MS analysis, the genus Pediococcus was predominant on MRS agar, whereas the genus Tetragenococcus was predominant on MRS agar+5% NaCl. There was no relationship between the distribution of bacterial species and market location.

Identification of Jeotgal Isolates by PCR-DGGE

DGGE banding patterns of the bacterial V3 region of the 16S rRNA gene from each jeotgal sample are shown in Fig. 1, and sequencing results are summarized in Table 3. Bacterial communities in galchi-jeotgal were more diverse than those in myeolchi-jeotgal.

Table 3 . Isolates present in galchi- and myeolchi-jeotgal samples identified by sequencing of the V3 region of the 16S rRNA gene after DGGE..

Bands (na)Galchi-jeotgal Species (NCBI Accession No.)IdentitybMyeolchi-jeotgal Species (NCBI Accession No.)Identityb
1Tetragenococcus halophilus (KJ699143.1)100%Weissella halotolerans (LC064886.1)100%
2Tetragenococcus halophilus (KP845287.1)98%Weissella halotolerans (LC064886.1)100%
3Leuconostoc citreum (KU060303.1)100%Tetragenococcus halophilus (KJ699143.1)100%
4Tetragenococcus halophilus (LC071840.1)100%Enterococcus sp. (KJ394442.1)96%
5Psychrobacter celer (KR051247.1)98%Weissella paramesenteroides (JN863617.1)98%
6Lactobacillus sakei (KT626399.1)99%Lactobacillus sakei (JN851763.1)100%
7Tetragenococcus halophilus (NR114788.2)100%Tetragenococcus halophilus (KJ699143.1)100%
8Tetragenococcus halophilus (LC071840.1)99%Tetragenococcus halophilus (KJ699143.1)98%
9Leuconostoc gelidum (LN890331.1)100%Tetragenococcus halophilus (KJ699143.1)100%
10Streptococcus sp. (AB371944.1)98%Tetragenococcus halophilus (NR114788.2)100%
11Tetragenococcus halophilus (KJ699143.1)99%Tetragenococcus muriaticus (LC096225.1)100%
12Tetragenococcus halophilus (EU689055.1)98%Tetragenococcus muriaticus (LC096225.1)100%
13Tetragenococcus halophilus (NR114788.2)100%--
14Tetragenococcus halophilus (KP997167.1)99%--
15Tetragenococcus muriaticus (KM042034.1)97%--
16Tetragenococcus muriaticus (KM042034.1)100%--
17Synechococcus sp. (DQ023295.1)95%--

aNumbers of bands are indicated in Fig. 1..

bPercentage identity of the 16S rRNA gene sequence with the most closely related type strain..



Figure 1. PCR-DGGE profiles of the bacterial V3 region of the 16S rRNA gene from (A) galchi- and (B) myeolchi-jeotgal samples. Sequencing results for excised bands are summarized in Table 3.

Five LAB, namely Lb. sakei, Leuconostoc citreum, Leuconostoc gelidum, T. halophilus, and T. muriaticus, and three non-LAB, including Synechococcus sp. and Psychrobacter celer, were identified from galchi-jeotgal. Streptococcus sp. was identified only to the genus level, and was therefore not classified as a lactic acid bacterium (Table 3). T. halophilus and T. muriaticus were present in all galchi-jeotgal samples. T. halophilus was represented by nine bands (no. 1, 2, 4, 7, 8, 11, 12, 13, and 14) of a total of 17 bands. In particular, bands no. 11 and 13 were in the same position as bands no. 9 and 10 of myeolchi-jeotgal and were identified as the same strains, respectively. Lactobacillus sakei (band no. 6) was detected in all galchi-jeotgal samples, with the exception of jeotgal from Se-3. L. citreum (band no. 3) and L. gelidum (band no. 9) were found in So-1. Streptococcus sp. (band no. 10) was detected from the product from Y-1. As non-LAB present in galchi-jeotgal, P. celer (band no. 5) and Synechococcus sp.(band no. 17) were detected in samples from markets Se-2 and Se-1, respectively. Comparison of the DGGE banding patterns for the five galchi-jeotgal samples revealed that the major bands were no. 6, 11, and 13, representing Lb. sakei and T. halophilus.

A total of five LAB (Lb. sakei, T. halophilus, T. muriaticus, W. halotolerans, and W. paramesenteroides) were identified from the myeolchi-jeotgal samples. Enterococcus sp. was identified to the genus level only and was therefore not classified as a lactic acid bacterium (Table 3). T. halophilus was detected in all myeolchi-jeotgal samples, and Lb. sakei was also detected in all myeolchi-jeotgal samples with the exception of the sample from market B-2. In addition, bands no. 1 and 2 of myeolchi-jeotgal samples from Se-1, Se-2, Se-3, and Y-1 markets were identified as W. halotolerans. Enterococcus sp. (band no. 4) and W. paramesenteroides (band no. 5) were detected only in myeolchi-jeotgal from Se-1 and B-1 markets, respectively. Five bands (no. 3, 7, 8, 9, and 10) that corresponded to T. halophilus were predominant. Bands no. 9 and 10 were relatively strong in all samples, indicating that T. halophilus was present in these samples at high concentration. Similarly, T. muriaticus, represented by bands no. 11 and 12, was also present at high concentration in myeolchi-jeotgal samples from Se-1, Se-2, and Se-3 markets. Myeolchi-jeotgal samples from Se-1 had the most diverse bacterial communities. Lb. sakei, T. halophilus, and T. muriaticus were predominant in both galchi- and myeolchi-jeotgal samples. Leuconostoc sp. and Weissella sp. were detected specifically in galchi- and myeolchi-jeotgal samples, respectively. According to previous studies, the reason for the difference in microbial communities was reported to be due to the microorganisms present in the raw materials of jeotgal samples [8, 17]. Therefore, galchi-and myeolchi-jeotgals showed the difference of microbial community composition as a result of their raw materials.

Many studies have shown that the bacterial community of kimchi is influenced by fermentation conditions and the main ingredients, such as garlic, red pepper powder, salted cabbage, and jeotgal [23]. In a previous study, the predominant bacteria in kimchi were reported to be Leuconostoc, Lactobacillus, and Weissella at the genus level [23-27], which we detected in our study as well. Some species of Weissella are involved in the early stage of fermentation [23] and Weissella species were present mostly in myeolchi-jeotgal in our study. In addition, some species of Leuconostoc have been reported to be involved in the late stage of kimchi fermentation [23]; in our study, Leuconostoc species were detected mainly in galchi-jeotgal. In particular, Lb. sakei, L. citreum, and L. gelidum were identified in galchi-jeotgal samples based on PCR-DGGE banding patterns. These results are consistent with the bacterial community composition reported for kimchi [25, 27].

In the culture-dependent method, Pediococcus species was predominant in MRS agar in two jeotgal samples, and Tetragenococcus halophilus was predominant in MRS + 5%NaCl agar. In the culture-independent method, Lb. sakei and T. halophilus were the dominant species in both jeotgal samples, whereas T. muriaticus was the dominant species in only the myeolchi-jeotgal sample. Many species identified by culture-dependent methods were not found in the culture-independent method (Table 4). The reason seems to be due to the presence of low proportions in the sample (<1%) or incomplete DNA extraction or PCR biases [28, 29]. By contrast, the strain shown in the culture-independent method was not isolated because it is not a living strain.

Table 4 . Profile of bacteria identified in galchi- and myeolchi-jeotgal samples by culture-dependent and -independent methods..

SampleMarketBacterial strains identified by culture-dependent methods (na)Bacterial strains identified by culture-independent methods

MRSMRS+5% NaCl
Galchi-jeotgalSe-1Enterococcus devriesei (14)Tetragenococcus halophilus (47)Lactobacillus sakei
Leuconostoc gelidum
Synechococcus sp. Tetragenococcus halophilus
Tetragenococcus muriaticus
Se-2Enterococcus faecium (1)
Pediococcus pentosaceus (21)
Weissella viridescens (2)
Pediococcus pentosaceus (17)
Tetragenococcus halophilus (33)
Lactobacillus sakei
Leuconostoc gelidum
Psychrobacter celer
Streptococcus sp.
Tetragenococcus halophilus
Tetragenococcus muriaticus
Se-3Leuconostoc mesenteroides (15)Leuconostoc mesenteroides (14)
Staphylococcus epidermidis (26)
Synechococcus sp.
Tetragenococcus halophilus
Tetragenococcus muriaticus
So-1Pediococcus acidilatici (21)
Pediococcus pentosaceus (15)
Pediococcus acidilatici (26)Lactobacillus sakei
Leuconostoc citreum
Leuconostoc gelidum
Tetragenococcus halophilus
Tetragenococcus muriaticus
Y-1Pediococcus acidilatici (50)Tetragenococcus halophilus (25)Lactobacillus sakei
Streptococcus sp.
Tetragenococcus halophilus
Tetragenococcus muriaticus
Myeolchi-jeotgalB-1Lactobacillus sakei (2)
Pediococcus pentosaceus (26)
Weissella halotolerans (28)Lactobacillus sakei
Tetragenococcus halophilus
Weissella paramesenteroides
B-2Pediococcus pentosaceus (29)Pediococcus pentosaceus (29)Tetragenococcus halophilus
Tetragenococcus muriaticus
B-3Staphylococcus epidermidis (20)Lactobacillus sakei (40)Lactobacillus sakei
Tetragenococcus halophilus
Se-1Lactobacillus sakei (25)Tetragenococcus halophilus (10)Enterococcus sp.
Lactobacillus sakei
Tetragenococcus halophilus Tetragenococcus muriaticus
Weissella halotolerans
Se-2Pediococcus pentosaceus (31)Lactobacillus curvatus (30)
Tetragenococcus halophilus (28)
Lactobacillus sakei
Tetragenococcus halophilus
Tetragenococcus muriaticus
Weissella halotolerans
Se-3Leuconostoc mesenteroides (11)Leuconostoc mesenteroides (23)
Tetragenococcus halophilus (12)
Lactobacillus sakei
Tetragenococcus halophilus
Tetragenococcus muriaticus
Weissella halotolerans
Y-1Tetragenococcus halophilus (26)Tetragenococcus halophilus (25)Lactobacillus sakei
Tetragenococcus halophilus
Weissella halotolerans

aNumber of identified isolates..



In this study, bacterial communities in galchi- and myeolchi-jeotgal samples were investigated using 16S rRNA gene sequencing, MALDI-TOF MS, and PCR-DGGE. MALDI-TOF MS is an effective tool that can be used to analyze numerous samples in a short time in contrast with 16S rRNA gene sequencing. Additionally, more information about bacterial communities can be acquired by using PCR-DGGE together with a culture-dependent method such as 16S rRNA gene sequencing or MALDI-TOF MS. In our analysis of bacterial communities in galchi- and myeolchi-jeotgal samples, we identified species in the genera Tetragenococcus, Pediococcus, and Lactobacillus as the predominant LAB. The LAB isolated from jeotgal can potentially be used as starter cultures for jeotgal or kimchi.

Supplemental Materials

Acknowledgments

This research was supported by the Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education (NRF-2017R1A6A3A11031293).

Conflict of Interest


The authors have no financial conflicts of interest to declare.

Fig 1.

Figure 1.PCR-DGGE profiles of the bacterial V3 region of the 16S rRNA gene from (A) galchi- and (B) myeolchi-jeotgal samples. Sequencing results for excised bands are summarized in Table 3.
Journal of Microbiology and Biotechnology 2018; 28: 1112-1121https://doi.org/10.4014/jmb.1803.03034

Table 1 . Sample information and chemical characterization of the galchi- and myeolchi-jeotgal samples used in this study..

Sample (fish material)RegionaMarketbpHSalinity (%)
Galchi-jeotgalSeoulSe-15.8332
(Hairtail)SeoulSe-25.8933
SeoulSe-35.9848
SokchoSo-16.6230
YeosuY-16.1737
Myeolchi-jeotgalBusanB-15.8933
(Anchovy)BusanB-26.1630
BusanB-36.1726
SeoulSe-15.6540
SeoulSe-26.1534
SeoulSe-35.9836
YeosuY-15.6636

aSamples were purchased from four different regions of Korea: Busan, Seoul, Sokcho, and Yeosu..

bMarkets in each region are abbreviated as follows: Busan: B; Seoul: Se; Sokcho: So; and Yeosu: Y..


Table 2 . Isolates identified from galchi- and myeolchi-jeotgal samples by 16S rRNA gene sequencing and MALDI-TOF MS..

SampleConcentration of NaCl in MRS agara16S rRNA sequencing (NCBI Accession No.)Similarity (%)2)MALDI-TOF MSScore valuecRatio of distribution (%)dMarket (no. of isolates)
Galchi-jeotgal0%Enterococcus devriesei (GQ337023.1)100Enterococcus devriesei DSM 22802T1.71510.072Se-1 (14)
Enterococcus faecium (CP011828.1)100Enterococcus faecium 110372.3790.719Se-2 (1)
Leuconostoc mesenteroides (KP764082.1)100Leuconostoc mesenteroides ssp. mesenteroides DSM20343T2.20110.792Se-3 (15)
Pediococcus acidilactici (KT275957.1)100Pediococcus acidilactici KCTC31012.61951.079So-1 (21), Y-1 (50)
Pediococcus pentosaceus (KR010991.1)100Pediococcus pentosaceus DSM 202062.02915.108Se-2 (21)
Pediococcus pentosaceus (KT327865.1)100Pediococcus pentosaceus DSM 202062.31910.791So-1 (15)
Weissella viridescens (LC065637.1)100Weissella viridescens DSM 20410T1.8781.439Se-2 (2)
Sub-total100.000139
5%Leuconostoc mesenteroides (KP764082.1)100Leuconostoc mesenteroides ssp. mesenteroides DSM20343T2.0207.447Se-3 (14)
Pediococcus acidilactici (AP012046.1)100Pediococcus acidilactici KCTC31012.70213.830So-1 (26)
Pediococcus pentosaceus (KR010991.1)100Pediococcus pentosaceus DSM 202061.8099.043Se-2 (17)
Staphylococcus epidermidis (KT427443.1)100Staphylococcus epidermidis DSM 32692.17313.830Se-3 (26)
Tetragenococcus halophilus (AP012046.1)100Tetragenococcus halophilus ATCC 333152.17113.298Y-1 (25)
Tetragenococcus halophilus (KJ699138.1)100Tetragenococcus halophilus ATCC 333152.24217.552Se-2 (33)
Tetragenococcus halophilus (LC071840.1)100Tetragenococcus halophilus ATCC 333152.17125.000Se-1 (47)
Sub-total100.000188
Total327
Myeolchi-jeotgal0%Lactobacillus sakei (KJ026631.1)100Lactobacillus sakei ssp. carnosus DSM 157402.19314.706Se-1 (25)
Lactobacillus sakei (KT327858.1)100Lactobacillus sakei DSM 201012.2081.176B-1 (2)
Leuconostoc mesenteroides (KP764082.1)100Leuconostoc mesenteroides ssp. mesenteroides DSM20343T2.166.471Se-3 (11)
Pediococcus pentosaceus (KP723364.1)100Pediococcus pentosaceus DSM 202062.11732.353B-1 (26), B-2 (29)
Pediococcus pentosaceus (KT757261.1)100Pediococcus pentosaceus KCTC35072.18218.235Se-2 (31)
Staphylococcus epidermidis (KJ571206.1)100Staphylococcus epidermidis DSM 48512.20811.765B-3 (20)
Tetragenococcus halophilus (NR075020.1)100Tetragenococcus halophilus ATCC 333152.02115.294Y-1 (26)
Sub-total100.000170
5%Lactobacillus curvatus (LC063167.1)100Lactobacillus curvatus DSM 204951.37513.333Se-2 (30)
Lactobacillus sakei (KT327858.1)100Lactobacillus sakei ssp. carnosus DSM 15831T2.23817.778B-3 (40)
Leuconostoc mesenteroides (KP764082.1)100Leuconostoc mesenteroides ssp. cremoris DSM 20346T2.16810.222Se-3 (23)
Pediococcus pentosaceus (KT327865.1)100Pediococcus pentosaceus DSM 202062.02012.889B-2 (29)
Tetragenococcus halophilus (KC170304.1)100Tetragenococcus halophilus ATCC 333152.0214.444Se-1 (10)
Tetragenococcus halophilus (KJ699143.1)100Tetragenococcus halophilus ATCC 333152.0335.333Se-3 (12)
Tetragenococcus halophilus (KP8452871)100Tetragenococcus halophilus ATCC 333152.34812.444Se-2 (28)
Tetragenococcus halophilus (NR075020.1)100Tetragenococcus halophilus ATCC 333152.11011.111Y-1 (25)
Weissella halotolerans (LC064886.1)100Weissella halotolerans DSM 20190T2.00412.444B-1 (28)
Sub-total100.000225
Total395

aTotal concentration of NaCl added to MRS agar..

bSimilarities of the 16S rRNA gene of identified strains to those present in the NCBI sequence database..

cLog score values were obtained as follows: ≥2.000: species-level identification; 1.700-1.999: genus-level identification; ≤1.699: not reliably identified..

dRatio of distribution (%) = number of isolates / total number of isolates × 100..


Table 3 . Isolates present in galchi- and myeolchi-jeotgal samples identified by sequencing of the V3 region of the 16S rRNA gene after DGGE..

Bands (na)Galchi-jeotgal Species (NCBI Accession No.)IdentitybMyeolchi-jeotgal Species (NCBI Accession No.)Identityb
1Tetragenococcus halophilus (KJ699143.1)100%Weissella halotolerans (LC064886.1)100%
2Tetragenococcus halophilus (KP845287.1)98%Weissella halotolerans (LC064886.1)100%
3Leuconostoc citreum (KU060303.1)100%Tetragenococcus halophilus (KJ699143.1)100%
4Tetragenococcus halophilus (LC071840.1)100%Enterococcus sp. (KJ394442.1)96%
5Psychrobacter celer (KR051247.1)98%Weissella paramesenteroides (JN863617.1)98%
6Lactobacillus sakei (KT626399.1)99%Lactobacillus sakei (JN851763.1)100%
7Tetragenococcus halophilus (NR114788.2)100%Tetragenococcus halophilus (KJ699143.1)100%
8Tetragenococcus halophilus (LC071840.1)99%Tetragenococcus halophilus (KJ699143.1)98%
9Leuconostoc gelidum (LN890331.1)100%Tetragenococcus halophilus (KJ699143.1)100%
10Streptococcus sp. (AB371944.1)98%Tetragenococcus halophilus (NR114788.2)100%
11Tetragenococcus halophilus (KJ699143.1)99%Tetragenococcus muriaticus (LC096225.1)100%
12Tetragenococcus halophilus (EU689055.1)98%Tetragenococcus muriaticus (LC096225.1)100%
13Tetragenococcus halophilus (NR114788.2)100%--
14Tetragenococcus halophilus (KP997167.1)99%--
15Tetragenococcus muriaticus (KM042034.1)97%--
16Tetragenococcus muriaticus (KM042034.1)100%--
17Synechococcus sp. (DQ023295.1)95%--

aNumbers of bands are indicated in Fig. 1..

bPercentage identity of the 16S rRNA gene sequence with the most closely related type strain..


Table 4 . Profile of bacteria identified in galchi- and myeolchi-jeotgal samples by culture-dependent and -independent methods..

SampleMarketBacterial strains identified by culture-dependent methods (na)Bacterial strains identified by culture-independent methods

MRSMRS+5% NaCl
Galchi-jeotgalSe-1Enterococcus devriesei (14)Tetragenococcus halophilus (47)Lactobacillus sakei
Leuconostoc gelidum
Synechococcus sp. Tetragenococcus halophilus
Tetragenococcus muriaticus
Se-2Enterococcus faecium (1)
Pediococcus pentosaceus (21)
Weissella viridescens (2)
Pediococcus pentosaceus (17)
Tetragenococcus halophilus (33)
Lactobacillus sakei
Leuconostoc gelidum
Psychrobacter celer
Streptococcus sp.
Tetragenococcus halophilus
Tetragenococcus muriaticus
Se-3Leuconostoc mesenteroides (15)Leuconostoc mesenteroides (14)
Staphylococcus epidermidis (26)
Synechococcus sp.
Tetragenococcus halophilus
Tetragenococcus muriaticus
So-1Pediococcus acidilatici (21)
Pediococcus pentosaceus (15)
Pediococcus acidilatici (26)Lactobacillus sakei
Leuconostoc citreum
Leuconostoc gelidum
Tetragenococcus halophilus
Tetragenococcus muriaticus
Y-1Pediococcus acidilatici (50)Tetragenococcus halophilus (25)Lactobacillus sakei
Streptococcus sp.
Tetragenococcus halophilus
Tetragenococcus muriaticus
Myeolchi-jeotgalB-1Lactobacillus sakei (2)
Pediococcus pentosaceus (26)
Weissella halotolerans (28)Lactobacillus sakei
Tetragenococcus halophilus
Weissella paramesenteroides
B-2Pediococcus pentosaceus (29)Pediococcus pentosaceus (29)Tetragenococcus halophilus
Tetragenococcus muriaticus
B-3Staphylococcus epidermidis (20)Lactobacillus sakei (40)Lactobacillus sakei
Tetragenococcus halophilus
Se-1Lactobacillus sakei (25)Tetragenococcus halophilus (10)Enterococcus sp.
Lactobacillus sakei
Tetragenococcus halophilus Tetragenococcus muriaticus
Weissella halotolerans
Se-2Pediococcus pentosaceus (31)Lactobacillus curvatus (30)
Tetragenococcus halophilus (28)
Lactobacillus sakei
Tetragenococcus halophilus
Tetragenococcus muriaticus
Weissella halotolerans
Se-3Leuconostoc mesenteroides (11)Leuconostoc mesenteroides (23)
Tetragenococcus halophilus (12)
Lactobacillus sakei
Tetragenococcus halophilus
Tetragenococcus muriaticus
Weissella halotolerans
Y-1Tetragenococcus halophilus (26)Tetragenococcus halophilus (25)Lactobacillus sakei
Tetragenococcus halophilus
Weissella halotolerans

aNumber of identified isolates..


References

  1. Koo O, Lee S, Chung K, Jang D, Yang H. 2016. Korean traditional fermented fish products: jeotgal. J. Ethn. Foods 3: 107-116.
    CrossRef
  2. Marui J, Boulom S, Panthavee W, Momma M, Kusumoto K, Nakahara K, et al. 2015. Culture-independent bacterial community analysis of the salty-fermented fish paste products of Thailand and Laos. Biosci. Microbiota Food Health 34: 45-52.
    Pubmed KoreaMed CrossRef
  3. Choi DK. 2012. The appearance of salted seafood in the east Asia and Vietnam's nuoc mam - focusing on the origin and popularization of fermented sea foods in Korea and in Vietnam. Asian Comp. Folklore 48: 201-246.
  4. Guan L, Cho KH, Lee JH. 2011. Analysis of the cultivable bacterial community in jeotgal, a Korean salted and fermented seafood, and identification of its dominant bacteria. Food Microbiol. 28: 101-113.
    Pubmed CrossRef
  5. Ahmadsah LSF, Kim E, Jung YS, Kim HY. 2018. Identification by PCR-DGGE, SDS-PAGE, and MALDI-TOF MS of LAB and fungi in laru, a fermented starter. J. Microbiol. Biotechnol. 28: 32-39.
    CrossRef
  6. Cho Y, Kim E, Lee Y, Han SK, Choo DW, Kim YR, et al. 2017. Rapid and accurate identification of Pediococcus species isolated from Korean fermented foods by MALDITOF MS with local database extension. Int. J. Syst. Evol. Microbiol. 67: 744-752.
    CrossRef
  7. Kim E, Cho Y, Lee Y, Han SK, Kim CG, Choo DW, et al. 2017. A proteomic approach for rapid identification of Weissella species isolated from Korean fermented foods on MALDI-TOF MS supplemented with an in-house database. Int. J. Food Microbiol. 243: 9-15.
    Pubmed CrossRef
  8. Kim MS, Park EJ. 2014. Bacterial communities of traditional salted and fermented seafoods from Jeju Island of Korea using 16S rRNA gene clone library analysis. J. Food Sci. 79: M927-M934.
    Pubmed CrossRef
  9. Han S, Hong Y, Kwak H, Kim E, Kim M, Shrivastav A, et al. 2014. Identification of lactic acid bacteria in pork meat and pork meat products using SDS-PAGE, 16S rRNA gene sequencing and MALDI-TOF mass spectrometry. J. Food Saf. 34: 224-232.
    CrossRef
  10. Nguyen DT, Van Hoorde K, Cnockaert M, De Brandt E, Aerts M, Binh Thanh L, et al. 2013. A description of the lactic acid bacteria microbiota associated with the production of traditional fermented vegetables in Vietnam. Int. J. Food Microbiol. 163: 19-27.
    Pubmed CrossRef
  11. Doan NT, Van Hoorde K, Cnockaert M, De Brandt E, Aerts M, Le Thanh B, et al. 2012. Validation of MALDI-TOF MS for rapid classification and identification of lactic acid bacteria, with a focus on isolates from traditional fermented foods in Northern Vietnam. Lett. Appl. Microbiol. 55: 265-273.
    Pubmed CrossRef
  12. Hong Y, Li J, Qin P, Lee SY, Kim HY. 2015. Predominant lactic acid bacteria in mukeunji, a long-term-aged kimchi, for different aging periods. Food Sci. Biotechnol. 24: 545-550.
    CrossRef
  13. Angelakis E, Million M, Henry M, Raoult D. 2011. Rapid and accurate bacterial identification in probiotics and yoghurts by MALDI-TOF mass spectrometry. J. Food Sci. 76: M568-M572.
    Pubmed CrossRef
  14. Lee SH, Jung JY, Jeon CO. 2014. Effects of temperature on microbial succession and metabolite change during saeu-jeot fermentation. Food Microbiol. 38: 16-25.
    Pubmed CrossRef
  15. Hong Y, Yang HS, Li J, Han SK, Chang HC, Kim HY. 2014. Identification of lactic acid bacteria in salted Chinese cabbage by SDS-PAGE and PCR-DGGE. J. Sci. Food Agric. 94: 296-300.
    Pubmed CrossRef
  16. Han KI, Kim YH, Hwang SG, Jung EG, Patnaik BB, Han YS, et al. 2014. Bacterial community dynamics of salted and fermented shrimp based on denaturing gradient gel electrophoresis. J. Food Sci. 79: M2516-M2522.
    Pubmed CrossRef
  17. Roh SW, Kim KH, Nam YD, Chang HW, Park EJ, Bae JW. 2010. Investigation of archaeal and bacterial diversity in fermented seafood using barcoded pyrosequencing. ISME J. 4: 1-16.
    Pubmed CrossRef
  18. Kim TW, Lee JH, Park MH, Kim HY. 2010. Analysis of bacterial and fungal communities in Japanese- and Chinesefermented soybean pastes using nested PCR-DGGE. Curr. Microbiol. 60: 315-320.
    Pubmed CrossRef
  19. Udomsil N, Rodtong S, Choi YJ, Hua Y, Yongsawatdigul J. 2011. Use of Tetragenococcus halophilus as a starter culture for flavor improvement in fish sauce fermentation. J. Agric. Food Chem. 59: 8401-8408.
    Pubmed CrossRef
  20. Collins MD, Williams AM, Wallbanks S. 1990. The phylogeny of Aerococcus and Pediococcus as determined by 16S rRNA sequence analysis: description of Tetragenococcus gen. nov. FEMS Microbiol. Lett. 58: 255-262.
    Pubmed CrossRef
  21. Masuda S, Yamaguchi H, Kurokawa T, Shirakami T, Tsuji RF, Nishimura I. 2008. Immunomodulatory effect of halophilic lactic acid bacterium Tetragenococcus halophilus Th221 from soy sauce moromi grown in high-salt medium. Int. J. Food Microbiol. 121: 245-252.
    Pubmed CrossRef
  22. Lee H, Choi Y, Hwang I, Hong S, Lee M. 2016. Relationship between chemical characteristics and bacterial community of a Korean salted-fermented anchovy sauce, Myeolchi-Aekjeot. LWT Food Sci. Technol. 73: 251-258.
    CrossRef
  23. Jung JY, Lee SH, Jeon CO. 2014. Kimchi microflora: history, current status, and perspectives for industrial kimchi production. Appl. Microbiol. Biotechnol. 98: 2385-2393.
    Pubmed CrossRef
  24. Kim M, Chun J. 2005. Bacterial community structure in kimchi, a Korean fermented vegetable food, as revealed by 16S rRNA gene analysis. Int. J. Food Microbiol. 103: 91-96.
    Pubmed CrossRef
  25. Lee JS, Heo GY, Lee JW, Oh YJ, Park JA, Park YH, et al. 2005. Analysis of kimchi microflora using denaturing gradient gel electrophoresis. Int. J. Food Microbiol. 102: 143-150.
    Pubmed CrossRef
  26. Park JM, Shin JH, Lee DW, Song JC, Suh HJ, Chang UJ, et al. 2010. Identification of the lactic acid bacteria in kimchi according to initial and over-ripened fermentation using PCR and 16S rRNA gene sequence analysis. Food S ci. Biotechnol. 19: 541-546.
    CrossRef
  27. Cho J, Lee D, Yang C, Jeon J, Kim J, Han H. 2006. Microbial population dynamics of kimchi, a fermented cabbage product. FEMS Microbiol. Lett. 257: 262-267.
    Pubmed CrossRef
  28. Zheng Y, Zheng XW, Han BZ, Han JS, Nout MJR, Chen JY. 2013. Monitoring the ecology of Bacillus during Daqu incubation, a fermentation starter, using culture-dependent and culture-independent methods. J. Microbiol. Biotechnol. 23: 614-622.
    Pubmed CrossRef
  29. Yan YZ, Qian YL, Ji FD, Chen JY, Han BZ. 2013. Microbial composition during Chinese soy sauce koji-making based on culture dependent and independent methods. Food Microbiol. 34: 189-195.
    Pubmed CrossRef