전체메뉴
검색
Article Search

JMB Journal of Microbiolog and Biotechnology

QR Code QR Code

Research article

References

  1. Pfaller MA, Pappas PG, Wingard JR. 2006. Invasive fungal pathogens: current epidemiological trends. Clin. Infect. Dis. 43: S3-S14.
    CrossRef
  2. Martinez LR, Fries BC. 2010. Fungal biofilms: relevance in the setting of human disease. Curr. Fungal Infect. Rep. 4: 266-275.
    Pubmed PMC CrossRef
  3. Ramage G, Martinez JP, Lopez-Ribot JL. 2006. Candida biofilms on implanted biomaterials: a clinically significant problem. FEMS Yeast Res. 6: 979-986.
    Pubmed CrossRef
  4. Ramage G, Rajendran R, Sherry L, Williams C. 2012. Fungal biofilm resistance. Int. J. Microbiol. 2012: 1-14.
    Pubmed PMC CrossRef
  5. Mathé L, Van Dijck P. 2013. Recent insights into Candida albicans biofilm resistance mechanisms. Curr. Genet. 59: 251-264.
    Pubmed PMC CrossRef
  6. Uppuluri P, Chaturvedi AK, Srinivasan A, Banerjee M, Ramasubramaniam AK, Köhler JR, et al. 2010. Dispersion as an important step in the Candida albicans biofilm developmental cycle. PLoS Pathog. 6: e1000828.
    Pubmed PMC CrossRef
  7. Mukherjee PK, Chandra J, Kuhn DM, Ghannoum MA. 2003. Mechanism of fluconazole resistance in Candida albicans biofilms: phase-specific role of efflux pumps and membrane sterols. Infect. Immun. 71: 4333-4340.
    Pubmed PMC CrossRef
  8. Campbell BC, Chan KL, Kim JH. 2012. Chemosensitization as a means to augment commercial antifungal agents. Front. Microbiol. 3: 79.
    Pubmed PMC CrossRef
  9. Cowen LE. 2008. The evolution of fungal drug resistance: modulating the trajectory from genotype to phenotype. Nat. Rev. Microbiol. 6: 187-198.
    Pubmed CrossRef
  10. Bink A, Pellens K, Cammue BPA, Thevissen K. 2011. A ntibiofilm strategies: how to eradicate Candida biofilms? Open Mycol. J. 5: 29-38.
    CrossRef
  11. Lee HS, Kim Y. 2017. Paeonia lactiflora inhibits cell wall synthesis and triggers membrane depolarization in Candida albicans. J. Microbiol. Biotechnol. 27: 395-404.
    Pubmed CrossRef
  12. Park SJ, Choi SJ, Shin WS, Lee HM, Lee KS, Lee KH. 2009. Relationship between biofilm formation ability and virulence of Candida albicans. J. Bacteriol. Virol. 39: 119-124.
    CrossRef
  13. Liu M, Seidel V, Katerere DR, Gray AI. 2007. Colorimetric broth microdilution method for the antifungal screening of plant extracts against yeast. Methods 42: 325-329.
    Pubmed CrossRef
  14. Chandra J, Kuhn DM, Mukherjee PK, Hoyer LL, McCormick T, Ghannoum MA. 2001. Biofilm formation by the fungal pathogen Candida albicans: development, architecture, and drug resistance. J. Bacteriol. 183: 5385-5394.
    Pubmed PMC CrossRef
  15. Thein ZM, Samaranayake YH, Samaranayake LP. 2007. In vitro biofilm formation of Candida albicans and non-albicans Candida s pecies u nder d ynam ic a nd a naerobic c onditions. Arch. Oral Biol. 52: 761-767.
    Pubmed CrossRef
  16. Skrzypek MS, Binkley J, Binkley G, Miyasato SR, Simison M, Sherlock G. 2017. The Candida Genome Database (CGD): incorporation of Assembly 22, systematic identifiers and visualization of high throughput sequencing data. Nucleic Acids Res. 45: D592-D596.
    Pubmed PMC CrossRef
  17. Untergasser A, Cutcutache I, Koressaar T, Ye J, Faircloth BC, Remm M, et al. 2012. Primer3 - new capabilities and interfaces. Nucleic Acids Res. 40: e115.
    Pubmed PMC CrossRef
  18. Kucharíková S, Tournu H, Lagrou K, Van Dijck P, Bujdakova H. 2011. Detailed comparison of Candida albicans and Candida glabrata biofilms under different conditions and their susceptibility to caspofungin and anidulafungin. J. Med. Microbiol. 60: 1261-1269.
    Pubmed CrossRef
  19. Sudbery P, Gow N, Berman J. 2004. The distinct morphogenic states of Candida albicans. Trends Microbiol. 12: 317-324.
    Pubmed CrossRef
  20. Merson-Davies LA, Odds FC. 1989. A morphology index for characterization of cell shape in Candida albicans. J. Gen. Microbiol. 135: 3143-3152.
    Pubmed CrossRef
  21. Hoyer LL. 2001. The ALS gene family of Candida albicans. Trends Microbiol. 9: 176-180.
    Pubmed CrossRef
  22. Li F, Svarovsky MJ, Karlsson AJ, Wagner JP, Marchillo K, Oshel P, et al. 2007. Eap1p, an adhesin that mediates Candida albicans biofilm formation in vitro and in vivo. Eukaryot. Cell 6: 931-939.
    Pubmed PMC CrossRef
  23. Moyes DL, Wilson D, Richardson JP, Mogavero S, Tang SX, Wernecke J, et al. 2016. Candidalysin is a fungal peptide toxin critical for mucosal infection. Nat. 532: 64-68.
    Pubmed PMC CrossRef
  24. Sundstrom P. 2002. Adhesion in Candida spp. Cell. Microbiol. 4: 461-469.
    Pubmed CrossRef
  25. Schaller M, Borelli C, Korting HC, Hube B. 2005. Hydrolytic enzymes as virulence factors of Candida albicans. Mycoses 48: 365-377.
    Pubmed CrossRef
  26. Schaller M, Schackert C, Korting HC, Januschke E, Hube B. 2000. Invasion of Candida albicans correlates with expression of secreted aspartic proteinases during experimental infection of human epidermis. J. Invest. Dermatol. 114: 712-717.
    Pubmed CrossRef
  27. Silva S, Negri M, Henriques M, Oliveira R, Williams DW, Azeredo J. 2012. Candida glabrata, Candida parapsilosis and Candida tropicalis: biology, epidemiology, pathogenicity and antifungal resistance. FEMS Microbiol. Rev. 36: 288-305.
    Pubmed CrossRef
  28. Gow NA, Brown AJ, Odds FC. 2002. Fungal morphogenesis and host invasion. Curr. Opin. Microbiol. 5: 366-371.
    Pubmed CrossRef
  29. Thompson DS, Carlisle PL, Kadosh D. 2011. Coevolution of morphology and virulence in Candida species. Eukaryot. Cell 10: 1173-1182.
    Pubmed PMC CrossRef
  30. Hoyer LL, Scherer S, Shatzman AR, Livi GP. 1995. Candida albicans ALS1: domains related to a Saccharomyces cerevisiae sexual agglutinin separated by a repeating motif. Mol. Microbiol. 15: 39-54.
    Pubmed CrossRef
  31. Hoyer LL, Payne TL, Bell M, Myers AM, Scherer S. 1998. Candida albicans ALS3 and insights into the nature of the ALS gene family. Curr. Genet. 33: 451-459.
    Pubmed CrossRef
  32. Rameau RD, Jackson DN, Beaussart A, Dufrêne YF, Lipke PN. 2016. The human disease-associated Aβ amyloid core sequence forms functional amyloids in a fungal adhesin. MBio 7: e01815-15.
    Pubmed PMC CrossRef
  33. Ramsook CB, Tan C, Garcia MC, Fung R, Soybelman G, Henry R, et al. 2010. Yeast cell adhesion molecules have functional amyloid-forming sequences. Eukaryot. Cell 9: 393-404.
    Pubmed PMC CrossRef

Related articles in JMB

More Related Articles

Article

Research article

J. Microbiol. Biotechnol. 2018; 28(3): 482-490

Published online March 28, 2018 https://doi.org/10.4014/jmb.1712.12041

Copyright © The Korean Society for Microbiology and Biotechnology.

Development of Candida albicans Biofilms Is Diminished by Paeonia lactiflora via Obstruction of Cell Adhesion and Cell Lysis

Heung-Shick Lee 1 and Younhee Kim 2*

1Department of Biotechnology and Bioinformatics, Korea University, Sejongsi 30019, Republic of Korea, 2Department of Korean Medicine, Semyung University, Jecheon 27136, Republic of Korea

Correspondence to:Younhee  Kim
ykim@semyung.ac.kr

Received: December 20, 2017; Accepted: January 3, 2018

Abstract

Candida albicans infections are often problematic to treat owing to antifungal resistance, as such infections are mostly associated with biofilms. The ability of C. albicans to switch from a budding yeast to filamentous hyphae and to adhere to host cells or various surfaces supports biofilm formation. Previously, the ethanol extract from Paeonia lactiflora was reported to inhibit cell wall synthesis and cause depolarization and permeabilization of the cell membrane in C. albicans. In this study, the P. lactiflora extract was found to significantly reduce the initial stage of C. albicans biofilms from 12 clinical isolates by 38.4%. Thus, to assess the action mechanism, the effect of the P. lactiflora extract on the adhesion of C. albicans cells to polystyrene and germ tube formation was investigated using a microscopic analysis. The density of the adherent cells was diminished following incubation with the P. lactiflora extract in an acidic medium. Additionally, the P. lactiflora-treated C. albicans cells were mostly composed of less virulent pseudohyphae, and ruptured debris was found in the serumcontaining medium. A quantitative real-time PCR analysis indicated that P. lactiflora downregulated the expression of C. albicans hypha-specific genes: ALS3 by 65% (p = 0.004), ECE1 by 34.9% (p = 0.001), HWP1 by 29.2% (p = 0.002), and SAP1 by 37.5% (p = 0.001), matching the microscopic analysis of the P. lactiflora action on biofilm formation. Therefore, the current findings demonstrate that the P. lactiflora ethanol extract is effective in inhibiting C. albicans biofilms in vitro, suggesting its therapeutic potential for the treatment of biofilmassociated infections.

Keywords: Biofilm, Candida albicans, hypha-specific gene, pseudohypha, qPCR, Paeonia lactiflora

Introduction

Although Candida species are commensal in healthy humans, they become opportunistic pathogens that can cause superficial and systemic diseases in seriously ill or immunocompromised patients [1]. Biofilm formation by fungi plays a key role in pathogenesis [2], and most diseases caused by Candida albicans are associated with biofilm growth [3]. Fungal biofilms display a reduced susceptibility to available antifungal drugs, when compared with their planktonic counterparts [4]. This fungal biofilm resistance to antifungal drugs is derived from complex and multifactorial mechanisms, such as a reduced growth rate, enhanced cell density, diverse stress responses, presence of persister cells, secretion of an extracellular matrix, upregulation of the membrane transporter system and efflux pumps, and differential regulation of drug targets [4, 5]. In the case of C. albicans, the biofilm is initiated by the adhesion of blastospores to a solid surface or other cells, followed by a transition from yeast to hyphal forms. Biofilms advance through an increased cell density, the presence of multilayers of cells, and elongation of the filaments to form a mesh-like network consisting of yeast, hyphae, and pseudohyphae. Additionally, sessile cells accumulate an extracellular polymer matrix, resulting in mature biofilms [6].

Despite the ongoing development of new antifungal agents, most available antifungals are ineffective against Candida biofilms owing to the requirement of high concentrations for activity [7] or they have significant side effects due to toxicity [8]. Moreover, the search for effective antifungals is hindered by the eukaryotic nature of fungal cells, since they evolve closely with their human hosts [9], limiting the number of drug targets that can be explored to selectively eradicate the pathogen. Thus, there is an urgent need to develop novel antifungals with low toxicity and high therapeutic activity. Plant products are generally used in traditional ethnomedicine, since they have effective antimicrobial and antifungal activities as a part of their defense mechanism [9]. Therefore, the development of phytochemicals against Candida biofilms could be an excellent strategy [10].

A previous study by the current authors demonstrated the antifungal activity of the ethanol extract from Paeonia lactiflora against C. albicans, which was associated with the synergistic actions of preventing synthesis of the cell wall (1,3)-β-D-glucan polymer and changing the membrane depolarization and permeability [11]. Therefore, this study investigated the ability of the P. lactiflora ethanol extract to reduce the development of C. albicans biofilms in vitro, and examined its mode of action against C. albicans biofilms using qRT-PCR analysis.

Materials and Methods

Fungal Strains and Growth Conditions

Candida albicans ATCC 18804 and Candida albicans SC5314 (ATCC MYA-2876) were procured from the Korean Culture Center of Microorganisms and American Type Culture Collection (USA), respectively. A total of 12 clinical C. albicans isolates, collected from candidiasis patients, were kindly provided by Prof. K.H. Lee [12]. The yeast strains were routinely cultivated in YM medium (yeast extract 0.3%, malt extract 0.3%, peptone 0.5%, and dextrose 1%) at 37°C with agitation.

Plant Material and Extraction

The e thanol e xtract f rom Paeonia lactiflora was prepared by lyophilization of a 70% ethanol extract from dried roots of P. lactiflora. The P. lactiflora extract was then dissolved in dimethyl sulfoxide (DMSO) at 100 mg/ml, and kept at -20°C until used [11]. The amphotericin B was purchased from Sigma (USA). For all tests, DMSO was used in the controls (no treatment) at levels equivalent to those used in the antifungal agent treatment groups.

Antifungal Susceptibility Test

The minimum inhibitory concentration (MIC) of P. lactiflora against C. albicans SC5314 was determined according to the modified Clinical and Laboratory Standards Institute (CLSI) protocols M27-A3 for the colorimetric broth microdilution method using resazurin (Sigma, USA) as an indicator of cell viability [13]. The colorimetric MIC end points were taken as the lowest sample concentration that stayed blue or the first dilution that changed from blue to slightly purple. Amphotericin B was used as the reference standard for CLSI M27-A3. The inoculated plates were incubated at 35°C for 24 h. All the assays were repeated in triplicate.

Effect of P. lactiflora Ethanol Extract on C. albicans Viability

An overnight C. albicans ATCC 18804 culture was adjusted in the YM medium to a final concentration of 5 × 106 cells/ml and incubated in the absence or presence of 1× MIC (196 μg/ml) of the P. lactiflora ethanol extract [11] at 37°C for 3 h with agitation. The cells were then harvested and resuspended in 20 μl of YM. Next, the cell suspension (5 μl) was mixed with 2 μl of a 0.1% methylene blue solution (Sigma, USA) on a slide glass and covered with a cover slip. The cell viability and morphology were observed using an inverted microscope.

Effect of P. lactiflora Ethanol Extract on C. albicans Adhesion to Polystyrene Plates

An overnight C. albicans ATCC 18804 culture was adjusted in YNB medium with 50 mM glucose (YNB/glucose) to a final concentration of 5 × 106 cells/ml. C. albicans cell suspensions (0.2 ml) were added to a flat-bottom 96-well polystyrene plate and the suspensions were with or without the P. lactiflora extract at 1× MIC at 37°C. Three hours later, the liquid medium was gently aspirated and the wells were washed with phosphate-buffered saline (PBS) to remove any loosely adhered cells. Forty microliters of PBS was added to each well, and adherent cells were examined using an inverted microscope. To visualize the C. albicans cell walls, the C. albicans cells were stained with 5 μl of 0.05%Calcofluor-White (Sigma, USA) for 1 min and examined using an inverted epifluorescence microscope.

Effect of P. lactiflora Ethanol Extract on Germ Tube Formation

An overnight C. albicans ATCC 18804 culture was adjusted using RPMI 1640 medium (RPMI 1640 with L-glutamine and without sodium carbonate buffered with MOPS, pH 7) containing 10% fetal bovine serum (FBS) to a concentration of 5 × 106 cells/ml.

C. albicans cell suspensions (0.2 ml) were added to a flat-bottom 96-well polystyrene plate with the P. lactiflora extract at 1× MIC. The plate was incubated at 37°C for 4 h and the effect of the

P. lactiflora ethanol extract on germ tube formation was investigated using an inverted microscope.

Quantification of Antibiofilm Activity

The antibiofilm activity of P. lactiflora was measured using the biofilms from the 12 clinical C. albicans isolates based on an XTT (2,3-bis(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide) reduction assay [14] with slight modifications. For each clinical C. albicans isolate, an overnight culture was adjusted using YNB/glucose to a concentration of 1 × 107 cells/ml. The C. albicans cells were allowed to form biofilms by aliquoting 0.2 ml of the C. albicans cell suspensions into a flat-bottom 96-well polystyrene plate, which was then incubated at 37°C for 3 h. Thereafter, the liquid medium was discarded and the wells were gently washed twice with PBS to remove any loosely adhered cells. To check the effect of the P. lactiflora ethanol extract on the biofilms, fresh YNB/glucose medium (0.2 ml) without or with the P. lactiflora ethanol extract at 1× MIC was placed into each well holding the initial stage of the biofilms. The plate was then incubated for an additional 16 h at 37°C with moist air. Thereafter, the planktonic cells were discarded by gently aspirating and washing the plate twice with 0.2 ml of PBS. Finally, the biofilms were quantitated using a tetrazolium XTT reduction assay [15]. All the experiments were carried out in quadruplicate. The baseline values were normalized to 100 and the results are expressed in percentages of inhibition. The data from one of three independent experiments are presented.

RNA Purification and cDNA Synthesis

C. albicans SC5314 cells grown overnight in YM broth at 37°C with agitation were adjusted in RPMI 1640 medium to a concentration of 1 × 107 cells/ml. The C. albicans cells were allowed to form biofilms by aliquoting 2.5 ml of the C. albicans cell suspensions into a flat-bottom 6-well polystyrene plate, which was then incubated at 37°C for 4 h. Thereafter, the non-adhered cells including the liquid medium were gently aspirated and the wells were washed twice with PBS to remove any loosely adhered cells. To examine the changes in the biofilm-associated gene expression, 2 ml of fresh RPMI medium or RPMI medium containing 196 μg/ml of the P. lactiflora ethanol extract was added to each well holding the 4 h-aged biofilms, and the plate was incubated for an additional 90 min at 37°C with moist air. All the reactions were performed in duplicate. The biofilm cells were all collected using a sterile cell scraper. The total RNA was then extracted from the biofilms using the Trizol reagent (Invitrogen, USA) and an RNeasy Mini Kit (Qiagen, Germany). The harvested cells were resuspended in 0.8 ml of the Trizol reagent and transferred to a Lysing matrix C containing glass beads (MP Biochemicals, USA). The C. albicans SC5314 cells were then disrupted using a Minilys tissue homogenizer (Bertin, France) with 6 runs of 30 sec under strong agitation and cooling on ice for 1 min between each run. Cell lysis was checked by examining the extract using an inverted microscope. The lysate was mixed with 0.2 ml of chloroform/ml Trizol, incubated at room temperature for 5 min, and centrifuged at 4°C at 12,000 ×g for 15 min. The aqueous phase was then carefully removed and the RNA was purified using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions. The cDNA was synthesized using the ReverTra Ace qPCR RT master mix with a gDNA remover (Toyobo, Japan) according to the manufacturer’s instructions.

Quantitative Real-Time PCR

Qiagen Rotogene Q was used as the gene analysis system. The amplification and detection of the biofilm genes were performed using a real-time PCR with the SYBR Green Realtime PCR master mix (Toyobo, Japan). The primers were designed from the C. albicans SC5314 genome sequence through CGD (Candida Genome Database) [16] using Primer3 software from NCBI Primer Blast [17], and synthesized by Macrogen (Korea). The primer sequences used for the gene expression analysis are shown in Table 1. All the reactions were carried out in triplicate. The final volume of each reaction was 20 μl, consisting of 10 μl of SYBR Green Master Mix, 1 μl of forward primer (0.5 μM), 1 μl of reverse primer (0.5 μM), 1 μl of cDNA, and 7 μl of RNase-free water. The PCR conditions comprised an activation step of 1 min at 95°C, followed by 40 cycles at 95°C for 15 sec, 60°C for 15 sec, and 72°C for 45 sec. Data were collected at the 72°C step of each cycle. The fold regulation of each target gene was calculated using the comparative Ct method, using ACT1 Ct to normalize the data, and the biofilm expression data were treated with a solvent control as the reference sample to determine the ΔΔCt values. The standard deviation (SD) of each gene expression value was calculated using Sigma plot 13.0. The results were normalized to ACT1 RNA, and considered statistically significant at p ≤ 0.05.

Table 1 . Primers used for qRT-PCR..

GenePrimerSequenceTm (°C)Amplified length (bp)
ACT1ForwardGACGCTCCAAGAGCTGTTTTC59.8108
ReverseGGATTGGGCTTCATCACCAAC59.5
ALS1ForwardGCCACAACCACCACAGTTAC59.3136
ReverseAATGAGGACGGGAAAATGATGG58.7
ALS3ForwardGCTGGTGGTTATTGGCAACG60.1142
ReverseATGGTAAGGTGGTCACAGCG60.0
EAP1ForwardCCAGCCCATCAGTTCCTACC59.8160
ReverseAGTGCAGAGCCAGATCCTTC59.5
ECE1ForwardTGCCGTCGTCAGATTGCCAG63.196
ReverseCCAACATCTGGAACGCCATC59.3
HWP1ForwardCCGGAATCTAGTGCTGTCGTC60.583
ReverseGCAGATGGTTGCATGAGTGG59.6
SAP1ForwardAACCAATGAGGCTGCTGGTG60.9110
ReverseTGGCAGCATTGGGAGAGTTG60.6


Statistical Analysis

The differences in the optical density (mean ± SD) of the individual biofilms incubated with the P. lactiflora ethanol extract and control were calculated using Student’s t-test. The SD of each optical density was calculated using Sigma plot 13.0, and considered statistically significant when the p-value was less than 0.05.

Results

Antifungal Susceptibility Assay

C. albicans ATCC 18804 has been as the test organism for studying the antifungal activity of the test samples in this study, since it is a standard C. albicans strain used by many Candida researchers. In this study, the P. lactiflora ethanol extract was found to be effective for inhibiting C. albicans biofilm development. However, to clarify the action mechanism using a qPCR analysis is difficult as the genome of C. albicans ATCC 18804 has not yet been sequenced. Therefore, for the gene expression analysis, this study used C. albicans SC5314, as its whole genome, a 28 Mb diploid composed of eight sets of chromosome pairs, has already been sequenced and is available from the CGD [16]. The MIC of the ethanol extract from P. lactiflora was also determined for C. albicans SC5314, which was used for the qRT-PCR analysis, according to CLSI M27-A3. The MICs of the P. lactiflora ethanol extract and amphotericin B for C. albicans SC5314 were 49 and 0.25 μg/ml, respectively (Table 2). The MICs of the P. lactiflora extract against other C. albicans and non-albicans strains from our previous studies were also included for comparison [11]. The results indicated a 4-fold greater susceptibility to the P. lactiflora ethanol extract by C. albicans SC5314 compared with C. albicans ATCC 18804.

Table 2 . Minimum inhibitory concentrations (MICs) of Paeonia lactiflora ethanol extract against different Candida species and strains..

MIC (μg/ml)Reference

P. lactifloraAmphotericin B
C. albicans SC5314490.25This study
C. albicans ATCC 188041960.2511
C. krusei ATCC 32196980.2511
C. glabrata ATCC 2001250.1311
C. tropicalis ATCC 750980.1311


Effect of P. lactiflora Ethanol Extract on C. albicans Cell Viability

C. albicans ATCC 18804 cells were grown in YM in the presence of the P. lactiflora ethanol extract at 1× MIC at 37°C for 3 h. The harvested cells were then stained with methylene blue. In contrast to the healthy ovoid C. albicans cells, where the cytoplasm was not stained with methylene blue (Fig. 1A), dead cells with blue-stained cytoplasm and ruptured cell debris were detected (Fig. 1B). It is also noteworthy that the P. lactiflora-treated C. albicans cells tended to form aggregates (Fig. 1B).

Figure 1. Effect of Paeonia lactiflora ethanol extract on Candida albicans viability. C. albicans ATCC 18804 cells were grown in a YM medium in the absence (A) or presence of 196 μg/ml P. lactiflora ethanol extract (B) at 37°C for 3 h with agitation. The harvested cells were stained with methylene blue and visualized under an inverted microscope at ×400 magnification. Arrows indicate cell debris. Bars, 20 μm.

Effect of P. lactiflora on Adhesion of C. albicans Cells to Polystyrene Plates

The adhesion assay was carried out using a YNB/glucose medium according to an antibiofilm activity assay [14]. C. albicans ATCC 18804 cells were treated with the P. lactiflora ethanol extract at 1× MIC at 37°C for 3 h and the non-adhered cells were removed by washing with PBS. In contrast to the well-adhered and evenly distributed C. albicans cells in Figs. 2A and 2C, non-adhered cell debris and cell aggregates are clearly shown in Figs. 2B and 2D. When using Calcofluor-White, a fluorescent stain that binds to cellulose and chitin in fungal cell walls, non-adhered fluorescent cell aggregates were found (Fig. 2D), along with some pseudohyphae (Fig. 2B).

Figure 2. Effect of Paeonia lactiflora ethanol extract on adhesion of Candida albicans cells to polystyrene. After C. albicans ATCC 18804 cells were incubated in the absence (panels A and C) or presence of 196 μg/ml P. lactiflora ethanol extract (panels B and D) at 37°C for 3 h in a flat-bottomed polystyrene plate, the medium including nonadherent cells was removed and PBS added. The adherent cells were investigated under an inverted microscope (panels A and B), whereas the adherent cells stained with Calcofluor-White were observed under UV light using an inverted epifluorescence microscope at ×400 magnification (panels C and D). Cell debris is shown by arrows. Bars, 20 μm.

Effect of P. lactiflora Ethanol Extract on Germ Tube Formation

C. albicans cells are known to form thicker biofilms in RPMI 1640 medium than in YNB/glucose medium [18]. Therefore, germ tubes from C. albicans ATCC 18804 cells were induced in RPMI 1640 medium containing 10% FBS, and the effect of the P. lactiflora ethanol extract was investigated. Unconstricted filaments extending from unbudded C. albicans ATCC 18804 cells were formed (Fig. 3A). Hyphae are not constricted at the neck of the mother cell with parallel sides along their entire length [19]. As shown in Fig. 3B, the P. lactiflora extract did not seemingly inhibit germ tube formation, yet the lengths of the P. lactiflora-treated C. albicans hyphae were shorter than those of the control. Pseudohyphal cells are constricted at the neck between the mother cell and the bud, and are wider at the center than at the two ends, yet the width and length of a pseudohyphal cell can be extremely different [19, 20]. In this study, typical constricted pseudohyphal cells were predominantly found, as indicated by the arrows, along with cell debris or membranous materials (Fig. 3B). As previously reported, the P. lactiflora ethanol extract inhibits the synthesis of the C. albicans cell wall and damages the cell membrane function, resulting in cell swelling and subsequent bursting due to osmotic pressure [11].

Figure 3. Effect of Paeonia lactiflora ethanol extract on germ tube formation. C. albicans ATCC 18804 cells were grown in RPMI 1640 medium containing 10% FBS in the absence (A) or presence of 196 μg/ml P. lactiflora ethanol extract (B) at 37°C for 4 h in a flat-bottomed 96-well polystyrene plate. The C. albicans germ tubes in the surrounding medium were visualized using an inverted microscope at ×400 magnification. In contrast to typical hyphal forms of C. albicans (panel A), the characteristic structures are indicated by arrows: p, pseudohyphae (black); d, ruptured debris (yellow); and m, membranous materials (white). Bars, 20 μm.

In Vitro Antibiofilm Activity of P. lactiflora against Initial Stage of C. albicans Biofilms

Adherence is considered a critical stage in biofilm formation. The inhibitory effect of the P. lactiflora extract on C. albicans biofilms was studied at the early stage of C. albicans biofilm development. Three-hour-aged C. albicans biofilms were incubated without or with the P. lactiflora extract at 1× MIC for 16 h. Tetrazolium salt XTT was used to monitor the metabolic activity of the biofilms formed by the 12 clinical C. albicans isolates (Table 3). The experimental data showed that the P. lactiflora ethanol extract significantly inhibited C. albicans biofilm formation by 38.4% (p < 0.01), confirming its effective anti-biofilm activity against C. albicans biofilms.

Table 3 . Inhibitory effect of the P. lactiflora ethanol extract on C. albicans biofilm development..

C. albicans strainsNo treatmentP. lactifloraRelative inhibition of biofilm formation (%)

A492
10.444 ± 0.0430.340 ± 0.10123.4
20.269 ± 0.0390.140 ± 0.017a48.0
30.492 ± 0.0240.326 ± 0.053a37.7
40.329 ± 0.0440.233 ± 0.019a29.2
50.381 ± 0.0470.317 ± 0.03216.8
60.338 ± 0.0430.216 ± 0.022a36.1
70.453 ± 0.0390.221 ± 0.046a51.2
80.154 ± 0.0190.086 ± 0.003a44.2
90.477 ± 0.0670.228 ± 0.019a52.2
100.422 ± 0.0710.209 ± 0.014a50.6
110.368 ± 0.0290.212 ± 0.022a42.4
120.411 ± 0.0370.291 ± 0.024a29.2
Mean ± SD0.378 ± 0.0960.235 ± 0.075a38.4 ± 11.7

Three hour-aged initial stage of C. albicans biofilms from 12 clinical isolates were incubated in the absence or presence of 196 μg/ml P. lactiflora ethanol extract for 16h at 37°C. Metabolic activity was assessed using the XTT reduction assay measuring the absorbance at 492 nm. Values reported are the means of quadruplicate determinations ± standard deviations (SD). A p value of ≤0.01 indicates a significant difference between no and the P. lactiflora extracttreatment and is marked with a..



Biofilm-Dependent Expression of Adhesin Genes

Since the process of yeast cell adhesion to a surface is essential for biofilm development, this study analyzed the gene expression changes known to be involved in yeast adhesion and biofilm formation, such as ALS1, ALS3, EAP1, ECE1, HWP1, and SAP1, where the expression level of each gene was normalized with the housekeeping gene ACT1 for both the P. lactiflora-treated and untreated biofilms. The proteins Als1 (agglutinin-like sequence 1) and Als3 play a role in the surface attachment of a biofilm [21]. Eap1 (enhanced adherence to polystyrene protein 1) is a cell wall adhesin, which is a glycosylphosphatidylinositol-anchored glucan-linked protein, and it plays a role in cell adhesion to polystyrene and epithelial cells [22]. During hyphal formation, Ece1 (extent of cell elongation 1) is processed into a smaller peptide candidalysin, a cytolytic peptide toxin, to activate or damage epithelial cells as the hyphal factor [23]. Hwp1 (hyphal wall protein 1) is involved in host cell attachment, and is not expressed during the yeast phase, but is highly expressed on germ tubes and hyphal surfaces [24]. SAP1 encodes the secreted aspartyl proteinase 1 protein, which is a member of the multigene SAP (secreted aspartic proteinase) family [25]. Sap activity is regarded as a virulence factor for C. albicans, and SAP1 expression has been found during the initial invasion of the skin and correlates with skin tissue damage [26]. As shown in Fig. 4, significant downregulation of ALS3 by 65% (p = 0.004), ECE1 by 34.9% (p = 0.001), HWP1 by 29.2% (p = 0.002), and SAP1 by 37.5% (p = 0.001) was observed after exposing the 4 h-aged C. albicans biofilms to 196 μg/ml P. lactiflora ethanol extract for 90 min. A reduced expression of ALS1 was also found in the P. lactiflora-treated biofilms, but the difference was not significant (p = 0.269). Meanwhile, a higher expression of EAP1 was found in the P. lactiflora-treated biofilms, but the difference was not significant (p = 0.086).

Figure 4. Effect of Paeonia lactiflora ethanol extract on expression of Candida albicans hypha-specific genes. C. albicans SC5314 biofilms formed in RPMI 1640 medium at 37°C for 4 h were treated without or with the P. lactiflora ethanol extract for 90 min at 37°C. The expression of the indicated genes was then analyzed by qRT-PCR. The expression level of each gene is shown after normalization with the housekeeping actin gene ACT1. The histogram shows the relative expression fold-changes of the genes following P. lactiflora treatment as compared with the control. Data are the mean of three independent experiments ± SD.

Discussion

Candida pathogenicity is determined by a variety of virulence factors, such as adherence to host surfaces, biofilm formation, and the secretion of hydrolytic enzymes, including proteases, phospholipases, and hemolysins [27]. When compared with conventional pharmaceutical drugs, plant extracts have synergistic advantages with multiple active components and fewer side effects, as proven by continued use in traditional medicine. The ethanol extract from P. lactiflora has already been shown to inhibit the synthesis of the C. albicans cell wall (1,3)-β-D-glucan polymer, leading to C. albicans cell lysis [11]. Moreover, the extract is also known to inhibit the function of the C. albicans cell membrane by depolarization and changing the permeability [11]. Therefore, in the current study, cell debris or membranous materials were clearly found among the C. albicans cells treated with the P. lactiflora ethanol extract (Figs. 1B, 2B, and 3B). It was also expected that the P. lactiflora extract would inhibit C. albicans biofilm formation, since it damages the cell wall integrity and hampers the functioning of the cell membrane. Thus, an XTT reduction assay demonstrated that the P. lactiflora extract at 1× MIC significantly reduced the average metabolic activity of the C. albicans cells within the biofilms by 38.4% (Table 3), suggesting that the extract has the potency to block biofilm development. However, P. lactiflora was not effective in reducing the germ tube formation of C. albicans (Fig. 2B). Rather, the P. lactiflora-treated cells were inclined to form pseudohyphae in the YNB/glucose medium (Fig. 2B), in which Candida cells normally grow as budding yeast forms due to the acidic pH of the medium. Therefore, the inhibitory effect of P. lactiflora on biofilm formation is clearly not due to the inhibition of germ tube formation. Notwithstanding, the density of adherent C. albicans cells in the P. lactiflora-treated group was lower than that of the control (Fig. 2B). One more notable phenomenon found in the P. lactiflora-treated C. albicans cells was that the C. albicans cells tended to adhere to each other to form cell aggregates or clumps without adhering to the plate (Figs. 1B, 2B, and 2D). Thus, to survive the harsh conditions resulting from a defective cell wall and damaged cell membrane due to the P. lactiflora extract, the C. albicans cells seemed to transit from a budding yeast to pseudohyphal forms, and adhered to each other to form cell aggregates.

C. albicans filaments are thought to be required for tissue invasion and yeast-form cells for dissemination in the host [28]. The stepwise evolution from yeast to pseudohyphae to hyphae is also believed to be related with increased virulence gene expression and the development of a variety of virulence properties [29]. The transition from yeast to filaments in C. albicans is regulated by multiple factors, such as the presence of serum, 37°C, pH, and depletion of nutrients [29].

The ALS gene family encoding cell-surface glycoproteins is known to be associated with adhesion to host surfaces and potentially other cellular processes [30]. In the P. lactiflora-treated biofilms, the expression of ALS3 and HWP1 was significantly reduced 0.650-fold and 0.292-fold, respectively, when compared with the control (Fig. 4). These data also agree well with the increased detachment of adherent cells (Fig. 2B). Moreover, the predominance of pseudohyphal forms among the C. albicans cells treated with the P. lactiflora extract coincides with the reduced expression of ALS3, as it has been reported that ALS3 is only transcribed in germ tubes and hyphae [31]. In contrast to the significantly reduced ALS3 expression, the slightly reduced ALS1 expression by 0.09-fold (p = 0.269) with the P. lactiflora treatment indicates that the importance of Als1 may not be greater than that of Als3 in biofilm development. Similarly, the previous report that ALS1 expression depends on the growth conditions [30] suggests that the role of Als1 is not essential.

In the P. lactiflora-treated biofilms, the expression of SAP1 was significantly decreased by 0.375-fold (p = 0.001), when compared with the control (Fig. 4). This also corresponds to the enhanced detachment of adherent cells (Figs. 2B and 2D). Moreover, the P. lactiflora-treated biofilms showed an upregulated expression of EAP1 by 0.198-fold, when compared with the control (p = 0.086). Whereas the expression of EAP1 has no apparent influence on the morphology of C. albicans, the N-terminal tandem repeat domain of Eap1 is known to support the pseudohyphal growth of S. cerevisiae [22]. Fungal glycoprotein adhesins aggregate into cell surface patches through amyloid-like interactions, and this adhesin clustering promotes cell-cell binding [32]. C. albicans Eap1 is a glycoprotein adhesin that forms insoluble amyloids, and amyloid formation is an important component of the cellular aggregation mediated by these proteins [33]. Thus, the enhanced expression of EAP1 in the P. lactiflora-treated C. albicans biofilms may possibly have been associated with the increased formation of cell aggregates and pseudohyphal growth. The expression of ECE1 was significantly inhibited by 0.349-fold (p = 0.001) in the P. lactiflora-treated C. albicans biofilms, suggesting that the virulence of C. albicans was also significantly weakened.

The switch from yeast to pseudohyphae to hyphae is regarded to be related to increased virulence gene expression and the development of different virulence properties [33]. Generally, pseudohyphae are ellipsoidal and are constricted at the septal junctions [19], whereas hyphae have parallel sides with a uniform width and possess true septa without constrictions [29]. Considering that the P. lactiflora-treated C. albicans cells often formed cell aggregates (Figs. 1B, 2B, and 2D) and transformed from budding yeast to pseudohyphae in an acidic medium (Fig. 2B), it would seem that the P. lactiflora treatment actually made the situation worse. Thus, although the C. albicans cells that encountered the P. lactiflora extract tried to switch their form from yeast to pseudohyphae to attach or invade surfaces or to form cell aggregates possibly to limit the surface area in the surrounding medium, the live ovoid or pseudohyphal cells became sick as their cell wall structure and membrane function were damaged as follows. First, the C. albicans cells in the cell aggregates were deemed dead, as some cells in the cell aggregates were stained blue with methylene blue (Fig. 1B). Second, the diameters of the hyphal tubes were narrower or the lengths of the hyphae were shorter than those of the control, meaning they were not vigorous (Fig. 3B). Finally, in a medium that induces germ tubes, the P. lactiflora-treated C. albicans cells did not transit from budding yeast forms to true hyphae, but rather to pseudohyphae, which are less virulent than hyphae (Fig. 3B). Therefore, it would seem that the P. lactiflora extract attenuated the virulence of C. albicans by obstructing the morphological change from a pseudohyphal to a hyphal filament.

In summary, the P. lactiflora ethanol extract showed a good inhibitory effect on biofilm formation by impeding cell adhesion to polystyrene via downregulation of the expression of Als3, Hwp1, Sap1, and Ece1, and obstructing the morphological transition from pseudohyphal to hyphal filaments. Furthermore, the extract hindered biofilm development by inhibiting cell wall synthesis and damaging the cell membrane function, which led to cell swelling and ultimately cell lysis due to osmotic pressure.

Acknowledgments

This paper was supported by a Semyung University Research Grant in 2015.

Conflict of Interest


The authors have no financial conflicts of interest to declare.

Fig 1.

Figure 1.Effect of Paeonia lactiflora ethanol extract on Candida albicans viability. C. albicans ATCC 18804 cells were grown in a YM medium in the absence (A) or presence of 196 μg/ml P. lactiflora ethanol extract (B) at 37°C for 3 h with agitation. The harvested cells were stained with methylene blue and visualized under an inverted microscope at ×400 magnification. Arrows indicate cell debris. Bars, 20 μm.
Journal of Microbiology and Biotechnology 2018; 28: 482-490https://doi.org/10.4014/jmb.1712.12041

Fig 2.

Figure 2.Effect of Paeonia lactiflora ethanol extract on adhesion of Candida albicans cells to polystyrene. After C. albicans ATCC 18804 cells were incubated in the absence (panels A and C) or presence of 196 μg/ml P. lactiflora ethanol extract (panels B and D) at 37°C for 3 h in a flat-bottomed polystyrene plate, the medium including nonadherent cells was removed and PBS added. The adherent cells were investigated under an inverted microscope (panels A and B), whereas the adherent cells stained with Calcofluor-White were observed under UV light using an inverted epifluorescence microscope at ×400 magnification (panels C and D). Cell debris is shown by arrows. Bars, 20 μm.
Journal of Microbiology and Biotechnology 2018; 28: 482-490https://doi.org/10.4014/jmb.1712.12041

Fig 3.

Figure 3.Effect of Paeonia lactiflora ethanol extract on germ tube formation. C. albicans ATCC 18804 cells were grown in RPMI 1640 medium containing 10% FBS in the absence (A) or presence of 196 μg/ml P. lactiflora ethanol extract (B) at 37°C for 4 h in a flat-bottomed 96-well polystyrene plate. The C. albicans germ tubes in the surrounding medium were visualized using an inverted microscope at ×400 magnification. In contrast to typical hyphal forms of C. albicans (panel A), the characteristic structures are indicated by arrows: p, pseudohyphae (black); d, ruptured debris (yellow); and m, membranous materials (white). Bars, 20 μm.
Journal of Microbiology and Biotechnology 2018; 28: 482-490https://doi.org/10.4014/jmb.1712.12041

Fig 4.

Figure 4.Effect of Paeonia lactiflora ethanol extract on expression of Candida albicans hypha-specific genes. C. albicans SC5314 biofilms formed in RPMI 1640 medium at 37°C for 4 h were treated without or with the P. lactiflora ethanol extract for 90 min at 37°C. The expression of the indicated genes was then analyzed by qRT-PCR. The expression level of each gene is shown after normalization with the housekeeping actin gene ACT1. The histogram shows the relative expression fold-changes of the genes following P. lactiflora treatment as compared with the control. Data are the mean of three independent experiments ± SD.
Journal of Microbiology and Biotechnology 2018; 28: 482-490https://doi.org/10.4014/jmb.1712.12041

Table 1 . Primers used for qRT-PCR..

GenePrimerSequenceTm (°C)Amplified length (bp)
ACT1ForwardGACGCTCCAAGAGCTGTTTTC59.8108
ReverseGGATTGGGCTTCATCACCAAC59.5
ALS1ForwardGCCACAACCACCACAGTTAC59.3136
ReverseAATGAGGACGGGAAAATGATGG58.7
ALS3ForwardGCTGGTGGTTATTGGCAACG60.1142
ReverseATGGTAAGGTGGTCACAGCG60.0
EAP1ForwardCCAGCCCATCAGTTCCTACC59.8160
ReverseAGTGCAGAGCCAGATCCTTC59.5
ECE1ForwardTGCCGTCGTCAGATTGCCAG63.196
ReverseCCAACATCTGGAACGCCATC59.3
HWP1ForwardCCGGAATCTAGTGCTGTCGTC60.583
ReverseGCAGATGGTTGCATGAGTGG59.6
SAP1ForwardAACCAATGAGGCTGCTGGTG60.9110
ReverseTGGCAGCATTGGGAGAGTTG60.6

Table 2 . Minimum inhibitory concentrations (MICs) of Paeonia lactiflora ethanol extract against different Candida species and strains..

MIC (μg/ml)Reference

P. lactifloraAmphotericin B
C. albicans SC5314490.25This study
C. albicans ATCC 188041960.2511
C. krusei ATCC 32196980.2511
C. glabrata ATCC 2001250.1311
C. tropicalis ATCC 750980.1311

Table 3 . Inhibitory effect of the P. lactiflora ethanol extract on C. albicans biofilm development..

C. albicans strainsNo treatmentP. lactifloraRelative inhibition of biofilm formation (%)

A492
10.444 ± 0.0430.340 ± 0.10123.4
20.269 ± 0.0390.140 ± 0.017a48.0
30.492 ± 0.0240.326 ± 0.053a37.7
40.329 ± 0.0440.233 ± 0.019a29.2
50.381 ± 0.0470.317 ± 0.03216.8
60.338 ± 0.0430.216 ± 0.022a36.1
70.453 ± 0.0390.221 ± 0.046a51.2
80.154 ± 0.0190.086 ± 0.003a44.2
90.477 ± 0.0670.228 ± 0.019a52.2
100.422 ± 0.0710.209 ± 0.014a50.6
110.368 ± 0.0290.212 ± 0.022a42.4
120.411 ± 0.0370.291 ± 0.024a29.2
Mean ± SD0.378 ± 0.0960.235 ± 0.075a38.4 ± 11.7

Three hour-aged initial stage of C. albicans biofilms from 12 clinical isolates were incubated in the absence or presence of 196 μg/ml P. lactiflora ethanol extract for 16h at 37°C. Metabolic activity was assessed using the XTT reduction assay measuring the absorbance at 492 nm. Values reported are the means of quadruplicate determinations ± standard deviations (SD). A p value of ≤0.01 indicates a significant difference between no and the P. lactiflora extracttreatment and is marked with a..


References

  1. Pfaller MA, Pappas PG, Wingard JR. 2006. Invasive fungal pathogens: current epidemiological trends. Clin. Infect. Dis. 43: S3-S14.
    CrossRef
  2. Martinez LR, Fries BC. 2010. Fungal biofilms: relevance in the setting of human disease. Curr. Fungal Infect. Rep. 4: 266-275.
    Pubmed KoreaMed CrossRef
  3. Ramage G, Martinez JP, Lopez-Ribot JL. 2006. Candida biofilms on implanted biomaterials: a clinically significant problem. FEMS Yeast Res. 6: 979-986.
    Pubmed CrossRef
  4. Ramage G, Rajendran R, Sherry L, Williams C. 2012. Fungal biofilm resistance. Int. J. Microbiol. 2012: 1-14.
    Pubmed KoreaMed CrossRef
  5. Mathé L, Van Dijck P. 2013. Recent insights into Candida albicans biofilm resistance mechanisms. Curr. Genet. 59: 251-264.
    Pubmed KoreaMed CrossRef
  6. Uppuluri P, Chaturvedi AK, Srinivasan A, Banerjee M, Ramasubramaniam AK, Köhler JR, et al. 2010. Dispersion as an important step in the Candida albicans biofilm developmental cycle. PLoS Pathog. 6: e1000828.
    Pubmed KoreaMed CrossRef
  7. Mukherjee PK, Chandra J, Kuhn DM, Ghannoum MA. 2003. Mechanism of fluconazole resistance in Candida albicans biofilms: phase-specific role of efflux pumps and membrane sterols. Infect. Immun. 71: 4333-4340.
    Pubmed KoreaMed CrossRef
  8. Campbell BC, Chan KL, Kim JH. 2012. Chemosensitization as a means to augment commercial antifungal agents. Front. Microbiol. 3: 79.
    Pubmed KoreaMed CrossRef
  9. Cowen LE. 2008. The evolution of fungal drug resistance: modulating the trajectory from genotype to phenotype. Nat. Rev. Microbiol. 6: 187-198.
    Pubmed CrossRef
  10. Bink A, Pellens K, Cammue BPA, Thevissen K. 2011. A ntibiofilm strategies: how to eradicate Candida biofilms? Open Mycol. J. 5: 29-38.
    CrossRef
  11. Lee HS, Kim Y. 2017. Paeonia lactiflora inhibits cell wall synthesis and triggers membrane depolarization in Candida albicans. J. Microbiol. Biotechnol. 27: 395-404.
    Pubmed CrossRef
  12. Park SJ, Choi SJ, Shin WS, Lee HM, Lee KS, Lee KH. 2009. Relationship between biofilm formation ability and virulence of Candida albicans. J. Bacteriol. Virol. 39: 119-124.
    CrossRef
  13. Liu M, Seidel V, Katerere DR, Gray AI. 2007. Colorimetric broth microdilution method for the antifungal screening of plant extracts against yeast. Methods 42: 325-329.
    Pubmed CrossRef
  14. Chandra J, Kuhn DM, Mukherjee PK, Hoyer LL, McCormick T, Ghannoum MA. 2001. Biofilm formation by the fungal pathogen Candida albicans: development, architecture, and drug resistance. J. Bacteriol. 183: 5385-5394.
    Pubmed KoreaMed CrossRef
  15. Thein ZM, Samaranayake YH, Samaranayake LP. 2007. In vitro biofilm formation of Candida albicans and non-albicans Candida s pecies u nder d ynam ic a nd a naerobic c onditions. Arch. Oral Biol. 52: 761-767.
    Pubmed CrossRef
  16. Skrzypek MS, Binkley J, Binkley G, Miyasato SR, Simison M, Sherlock G. 2017. The Candida Genome Database (CGD): incorporation of Assembly 22, systematic identifiers and visualization of high throughput sequencing data. Nucleic Acids Res. 45: D592-D596.
    Pubmed KoreaMed CrossRef
  17. Untergasser A, Cutcutache I, Koressaar T, Ye J, Faircloth BC, Remm M, et al. 2012. Primer3 - new capabilities and interfaces. Nucleic Acids Res. 40: e115.
    Pubmed KoreaMed CrossRef
  18. Kucharíková S, Tournu H, Lagrou K, Van Dijck P, Bujdakova H. 2011. Detailed comparison of Candida albicans and Candida glabrata biofilms under different conditions and their susceptibility to caspofungin and anidulafungin. J. Med. Microbiol. 60: 1261-1269.
    Pubmed CrossRef
  19. Sudbery P, Gow N, Berman J. 2004. The distinct morphogenic states of Candida albicans. Trends Microbiol. 12: 317-324.
    Pubmed CrossRef
  20. Merson-Davies LA, Odds FC. 1989. A morphology index for characterization of cell shape in Candida albicans. J. Gen. Microbiol. 135: 3143-3152.
    Pubmed CrossRef
  21. Hoyer LL. 2001. The ALS gene family of Candida albicans. Trends Microbiol. 9: 176-180.
    Pubmed CrossRef
  22. Li F, Svarovsky MJ, Karlsson AJ, Wagner JP, Marchillo K, Oshel P, et al. 2007. Eap1p, an adhesin that mediates Candida albicans biofilm formation in vitro and in vivo. Eukaryot. Cell 6: 931-939.
    Pubmed KoreaMed CrossRef
  23. Moyes DL, Wilson D, Richardson JP, Mogavero S, Tang SX, Wernecke J, et al. 2016. Candidalysin is a fungal peptide toxin critical for mucosal infection. Nat. 532: 64-68.
    Pubmed KoreaMed CrossRef
  24. Sundstrom P. 2002. Adhesion in Candida spp. Cell. Microbiol. 4: 461-469.
    Pubmed CrossRef
  25. Schaller M, Borelli C, Korting HC, Hube B. 2005. Hydrolytic enzymes as virulence factors of Candida albicans. Mycoses 48: 365-377.
    Pubmed CrossRef
  26. Schaller M, Schackert C, Korting HC, Januschke E, Hube B. 2000. Invasion of Candida albicans correlates with expression of secreted aspartic proteinases during experimental infection of human epidermis. J. Invest. Dermatol. 114: 712-717.
    Pubmed CrossRef
  27. Silva S, Negri M, Henriques M, Oliveira R, Williams DW, Azeredo J. 2012. Candida glabrata, Candida parapsilosis and Candida tropicalis: biology, epidemiology, pathogenicity and antifungal resistance. FEMS Microbiol. Rev. 36: 288-305.
    Pubmed CrossRef
  28. Gow NA, Brown AJ, Odds FC. 2002. Fungal morphogenesis and host invasion. Curr. Opin. Microbiol. 5: 366-371.
    Pubmed CrossRef
  29. Thompson DS, Carlisle PL, Kadosh D. 2011. Coevolution of morphology and virulence in Candida species. Eukaryot. Cell 10: 1173-1182.
    Pubmed KoreaMed CrossRef
  30. Hoyer LL, Scherer S, Shatzman AR, Livi GP. 1995. Candida albicans ALS1: domains related to a Saccharomyces cerevisiae sexual agglutinin separated by a repeating motif. Mol. Microbiol. 15: 39-54.
    Pubmed CrossRef
  31. Hoyer LL, Payne TL, Bell M, Myers AM, Scherer S. 1998. Candida albicans ALS3 and insights into the nature of the ALS gene family. Curr. Genet. 33: 451-459.
    Pubmed CrossRef
  32. Rameau RD, Jackson DN, Beaussart A, Dufrêne YF, Lipke PN. 2016. The human disease-associated Aβ amyloid core sequence forms functional amyloids in a fungal adhesin. MBio 7: e01815-15.
    Pubmed KoreaMed CrossRef
  33. Ramsook CB, Tan C, Garcia MC, Fung R, Soybelman G, Henry R, et al. 2010. Yeast cell adhesion molecules have functional amyloid-forming sequences. Eukaryot. Cell 9: 393-404.
    Pubmed KoreaMed CrossRef