Aspergillus nidulans is ubiquitous in the environment and plays diverse roles in human life [1]. A. nidulans is widely used as a model fungus to investigate the biology of filamentous fungi [2, 3] and is also used as a fungal cell factory that can produce heterologous enzymes such as, laccases, and lipases [4]. However, A. nidulans also has detrimental effects and is a human pathogen that causes chronic granulomatous disease in immunocompromised patients [5, 6]. This fungus also produces sterigmatocystin, which is a mutagenic and carcinogenic mycotoxin [7, 8]. Therefore, continued study of A. nidulans biology is required. In A. nidulans, a sexual or asexual differentiation process is induced depending on external environmental conditions, and developmental-specific morphogenesis occurs during these processes [9]. A. nidulans is a homothallic fungus and under dark conditions undergoes sexual development without a mating partner to produce cleistothecia (sexual fruiting bodies) [10]. However, A. nidulans mainly undergoes asexual differentiation to form conidiophores that bear asexual spores (conidia), which act as infectious particles for propagation [11]. The processes of the formation of cleistothecia or conidia are controlled by multiple regulators and signaling pathways [12].

The forkhead transcription factors contain a DNA-binding domain with a winged helix structure called the Box (FOX) [13, 14]. Forkhead proteins are conserved in fungi, yeast, and animals, and play a variety role, including development, organogenesis aging, and metabolism [15, 16]. In Saccharomyces cerevisiae and Candida albicans, the forkhead transcription factors are important for fungal morphogenesis [17, 18], and in Magnaporthe oryzae, these factors regulate fungal virulence, development, and stress response [19]. In. A. nidulans, six forkhead genes, fkhA–fkhF, were found in the A. nidulans genome [19, 20], and three of these genes, fkhA (fhpA), fkhE, and fkhF, have been characterized in A. nidulans. Kim et al., found that FkhA can act as a positive regulator for sexual development [21], whereas FkhE and FkhF are involved in asexual development in A. nidulans [20, 22]. However, the roles of the other three genes have yet to be characterized.

Herein, we examined the level of fkhA–fkhF mRNA in hyphae and conidia and found that the mRNA levels of fkhB (AN2854) and fkhD (AN4985) were significantly higher in asexually developing cells and conidia than those in hyphae. We further characterized these genes and found that FkhB, but not FkhD, plays a key role in growth, development, and conidial heat tolerance in A. nidulans.

Construction of fkhB and fkhD Deletion Mutant Strains

Fungal strains and oligonucleotides used in this study are listed in Tables 1 and 2, respectively. To generate the disruption cassettes, the double-joint PCR (DJ-PCR) method was used [23]. Briefly, the 5' and 3' regions of the fkhB or fkhD genes were amplified with primer pairs OHS1279/OHS1281 and OHS1280/OHS1282 or OHS1287/OHS1288 and OHS1289/OHS1290, respectively. The Aspergillus fumigatus pyrG (AfupyrG) gene, for the selection marker, was amplified with primers OHS089/OHS090. In the joint PCR, the disruption cassettes were amplified from the combined 5' and 3' regions of the fkhB and fkhD gene and the AfupyrG marker using primer pair OHS1283/OHS1284 and OHS1291/OHS1292, respectively. To generate protoplast, RJMP 1.59 conidia were inoculated in liquid yeast glucose (YG, minimal media (MM) with 5 g/l yeast extract and 10 g/l dextrose) medium and cultured for 14 h at 30°C. The germ tubes or hyphae were incubated with the Vinoflow FCE lysing enzyme (Novozymes, Denmark) to remove cell wall components [24]. The protoplasts were mixed with the fkhB or fkhD gene deletion cassettes, and transformed cells were cultured in the 0.6% KCl selection medium (MM with 1%glucose (MMG) without uridine or uracil). To confirm the fkhB or fkhD gene deletion strains, PCR and restriction enzyme digestion were conducted. Three strains for each gene were isolated and used for phenotypic characterization.

Table 1 . Aspergillus strains used in this study..

Strain	Relevant genotype	References
FGSC4	A. nidulans wild type, veA+	FGSCa
TNJ36	pyrG89; pyroA4; pyrG+,veA+	[41]
RJMP1.59	pyrG89; pyroA4, veA+	[42]
TSY7.1–3	pyrG89; pyroA4; ΔfkhB::AfupyrG+; veA+	This study
TSY9.1–3	pyrG89; pyroA::fkhB(p)::fkhB::FLAG3x::pyroAb; ΔfkhB::AfupyrG+; veA+	This study
TSY12.1–3	pyrG89; pyroA4; ΔfkhD::AfupyrG+; veA+	This study

^aFungal Genetic Stock Center.

^bThe 3/4 pyroA marker causes targeted integration at the pyroA locus.

Table 2 . Oligonucleotides used in this study..

Name	Sequence (5’–3’)a	Purpose
OHS0089	GCTGAAGTCATGATACAGGCCAAA	5’ AfupyrG marker_F
OHS0090	ATCGTCGGGAGGTATTGTCGTCAC	3’ AfupyrG marker_R
OHS1279	CCAGTCGGAGTGGGTTGA	5’ fkhB DF
OHS1280	GGCTTTGGCCTGTATCATGACTTCA AACCGATAGAGCTCTGTGGA	3’ fkhB DR
OHS1281	TTTGGTGACGACAATACCTCCCGAC CTTTCACTTGTCTGGGGGATG	3’ fkhB with AfupyrG tail
OHS1282	CGTTGGCATACCAGTCCTG	5’ fkhB with AfupyrG tail
OHS1283	GTCCAAGGCGGATGTTGAC	5’ fkhB NF
OHS1284	GGTCATGGCTCAGTCTACCT	3’ fkhB NR
OHS1673	AATT GCGGCCGC GAGCATGAATGGTTCGCTG	5’ fkhB with promoter and Not1
OHS1674	AATT GCGGCCGC GGCATTGTTGAGCTGTCG	3’ fkhB with Not1
OHS0044	GTAAGGATCTGTACGGCAAC	Actin_RT_F
OHS0045	AGATCCACATCTGTTGGAAG	Actin_RT_R
OHS1285	GAAGAACGCAACTGGCCTTA	5’ fkhB RT_F
OHS1286	AAGACGGACCATCGTCGTAA	5’ fkhB RT_R
OHS1293	GACGCCAATGGAGGGTTTAC	5’ fkhD RT_F
OHS1294	GCTCGGATCCTGCTACTGAT	5’ fkhD RT_R
OHS0580	CAAGGCATGCATCAGTACCC	brlA_RT_F
OHS0581	AGACATCGAACTCGGGACTC	brlA_RT_R
OHS0779	ATTGACTGGGAAGCGAAGGA	abaA_RT_F
OHS0780	CTGGGCAGTTGAACGATCTG	abaA_RT_R
OHS1287	ACTCGTCGAGGCCATCTAC	fkhD_5’ DF
OHS1288	GCTGCACCTCCAATCACC	fkhD_3’ DR
OHS1289	GGCTTTGGCCTGTATCATGACTTCA GGTCTGCGACGATGACATGA	fkhD_Rev with AfupyrG TR
OHS1290	TTTGGTGACGACAATACCTCCCGAC ACCCATCCTTACACTTCACTGC	fkhD_For with AfupyrG TF
OHS1291	CCGTCATACGACTGCTGC	fkhD_ 5’ NF
OHS1292	GAGTGGAGAGGCAGAGAGG	fkhD_ 3’ NR

^aTail sequences are shown in italics. Restriction enzyme sites are in bold..

Construction of fkhB-Complemented Strains

For the fkhB-complemented strains, the predicted promoter and open reading frame of fkhB were amplified with primer pair OHS1673/OHS1674. The PCR product was digested with NotI, and ligated into pHS13 [25]. Ligation products were transformed into Escherichia coli DH5α, which was subsequently grown in Luria–Bertani medium with ampicillin (100 μg/ml, Sigma-Aldrich, USA). The resulting plasmid pSY1 was introduced into the recipient ΔfkhB (TSY 7.1) strain to produce strains TYS9.1–3. To verity the Complemented strains PCR and quantitative reverse-transcription (qRT) PCR assays were conducted.

Phenotypic Analysis of Growth and Asexual Development

To check the asexual development, fungal strains were solid MMG agar plates and the plates were incubated at 37°C for 5–7 days in the light or dark conditions. Images of the plate were taken with a Pentax MX-1 digital camera. To take images for the conidiophore structures, the agar containing conidiophores was cut into small blocks and the blocks were examined under a Zeiss Lab. A1 microscope equipped with AxioCam 105C and AxioVision (Rel. 4.9) digital imaging software.

qRT-PCR Analysis

For RNA isolation and qRT-PCR were conducted as described previously [26]. The vegetative, asexual development, and conidia samples were collected as described previously [27, 28]. Each sample was placed into a 2-ml tube with zirconia/silica beads (RPI, USA) and TRIzol reagent (Invitrogen, USA). Then, samples were homogenized using a Mini-Bead beater (BioSpec Products Inc., USA). Homogenized samples were centrifuged, and the aqueous phase was transferred to new tubes and mixed with ice-cold isopropanol. After isopropanol precipitation, the pellets were washed with 70% ethanol and dissolved in RNase-free water. Quantification of total RNA was measured using UV spectroscopy. To synthesis of cDNA, GoScript Reverse transcriptase (Promega, USA) was used. An iTaq Universal SYBR Green Supermix (Bio-Rad, USA) and CFX96 Touch Real-Time PCR (Bio-Rad) were used for quantitative PCR. The β-actin gene was used as a control. All experiments were performed in triplicate.

Cleistothecium Assay

To assess the size of cleistothecium, each strain was point-inoculated onto sexual media (SM) agar plates. The plates were incubated at 37°C for 7 days in the dark condition [29]. After culture, plates were washed with 70%ethanol to remove conidiophores and conidia. After washing, diameters of ten representative cleistothecia were measured using a Zeiss Lab. A1 microscope equipped with AxioCam 105C and AxioVision (Rel. 4.9) digital imaging software.

Trehalose Analysis

The trehalose assay was conducted as described previously [30]. Two-day-old conidia (2 × 10⁸) were collected using resuspension buffer (ddH₂O with 0.01% Triton X-100 (Sigma-Aldrich)). Samples were centrifuged, and the supernatant was discarded. Pelleted samples were resuspended with 200 μl of resuspension buffer and incubated at 95°C for 20 min. After incubation, samples were centrifuged, and supernatant was transferred to new tubes, mixed with 0.2 M sodium citrate (pH 5.5, Sigma-Aldrich), and further incubated with or without trehalase (3 mU, Sigma-Aldrich) at 37°C for 8 h. All experiments were performed in triplicate.

Thermal Stress Tolerance Tests

Thermal stress tolerance was assessed as previously described [31]. Two-day-old conidia (1 × 10³ per ml) were incubated at 55°C for 30 min After incubation; approximately 100 conidia were spread on solid MMG and incubated at 37°C for 2 days. Colonies were counted, and survival rates calculated as the ratio of the number of grown colonies relative to the number of conidia not treated with heat.

Statistical Analysis

For statistical analysis, GraphPad Prism Version 5.01 software was used. Student’s unpaired t-test was conducted to evaluate statistical differences between control and mutant strains. Data are reported as mean ± standard deviation.

Role of FkhB in Fungal Growth and Asexual Development

A previous study identified six forkhead genes in the A. nidulans genome (Fig. 1A) [20]. We assessed the mRNA expression of these genes during the life cycle and found that levels of fkhB and fkhD mRNA were high in conidia during the life cycle (Fig. S1). Consequently, we hypothesized that FkhB and FkhD may play an important role in conidiogenesis or asexual development. We first checked the level of fkhB and fkhD mRNA during the life cycle and found high levels of fkhB mRNA expressed in the late stage of asexual development and in conidia (Fig. 1B). High levels of fkhD mRNA were expressed during asexual development and in conidia. We then generated fkhB (ΔfkhB) and fkhD (ΔfkhD) deletion mutant strains and evaluated their morphology. We found that the colony morphology of the ΔfkhB mutant strain, but not that of the ΔfkhD strain, differed from that of the control strains (Fig. 1C). Therefore, we studied the role of FkhB, but not FkhD, and generated complemented strains (C’fkhB).

Figure 1. Transcript levels and mutant phenotypes of fkhB and fkhD in A. nidulans. (A) Structure of the putative forkhead proteins found in A. nidulans genome. (B) Levels of fkhB and fkbD mRNA in A. nidulans life cycle. (C) Colony photographs of control (TNJ36), ΔfkhB (TSY7.1), and ΔfkhD (TSY12.2) strains point-inoculated onto solid MM plate and grown at 37°C for 5 days.

To investigate the role of FkhB in fungal growth and asexual development, control, ΔfkhB, and C’ fkhB strains were inoculated onto solid MMG media and the morphology of conidiophore, diameter of colonies, and number of conidia assessed (Fig. 2). First, the morphology of ΔfkhB mutant conidiophores had a smaller morphology and an abnormal shape compared with that of the control and C’fkhB strains (Fig. 2A); the color of the ΔfkhB colony was light brown, rather than green, when grown in light conditions. The colony diameter was smaller than that of the control or C’fkhB strains grown in light and dark conditions (Fig. 2B). The ΔfkhB mutant strains exhibited a lower number of conidia compared with that of the control or C’fkhB strains in both conditions (Fig. 2C). We then checked the mRNA expression of brlA and abaA, key regulators for asexual development [11]. The levels of brlA and abaA mRNA in the ΔfkhB mutant had decreased 48 h after induction of asexual developmental (Fig. 2D). Overall, these results show that FkhB is a key regulator of correct asexual development in A. nidulans.

Figure 2. Function of FkhB in asexual development. (A) Colony photographs of control (Con, TNJ36), ΔfkhB (TSY7.2), and C’ fkhB (TSY9.1) strains point-inoculated onto solid MM plate and grown at 37°C for 5 days under dark or light conditions. Left panels show conidiophore of control (TNJ36), ΔfkhB (TSY7.2), and C’ fkhB (TSY9.1) strains. (B) Quantitative analysis of colony diameter for control (TNJ36), ΔfkhB (TSY7.2), and C’ fkhB (TSY9.1) shown in (A) (***p < 0.001, **p < 0.01). (C) Quantitative analysis of asexual spores of the strains shown in (A) (**p < 0.01, *p < 0.05). (D) mRNA expression of brlA and abaA in control (TNJ36), ΔfkhB (TSY7.2), and C’ fkhB (TSY9.1) strains (***p < 0.001). All experiments were performed in triplicates.

The Function of FkhB in Sexual Development

We hypothesized that FkhB would be involved in the formation of sexual fruiting bodies as this protein is involved in asexual development. To test this hypothesis, control, ΔfkhB, and C’ fkhB strains were inoculated onto solid SM plates that were incubated at 37°C for 7 days (Fig. 3A). After culturing, plates were washed with 70%ethanol and the size of cleistothecia of the control, ΔfkhB, and C’ fkhB strains were then checked. The ΔfkhB cleistothecia were smaller than those of the control or C' fkhB at 7 days (Fig. 3B). The size of ΔfkhB strain for 14-day culture remained smaller than that of the control strain (Figs. 3C-3D). Overall, these results suggest that FkhB is a key regulator for appropriate sexual development in A. nidulans.

Figure 3. Function of FkhB in sexual development. (A) Phenotypic images of control (TNJ36), ΔfkhB (TSY 7.2), and C’ fkhB (TSY9.1) strains inoculated onto bottom sexual media (SM) and incubated at 37°C for 7 days under dark conditions. Middle panel shows the cleistothecia observed by microscopy after washing off the conidia. (B) Quantitative analysis of cleistothecium size shown in (A) (***p < 0.001). (C) Phenotypic images of control (TNJ36), ΔfkhB (TSY 7.2), and C’ fkhB (TSY9.1) strains inoculated onto bottom sexual media (SM) and incubated at 37°C for 14 days under dark conditions. Middle panel shows the cleistothecia observed by microscopy after washing off the conidia. (D) Quantitative analysis of cleistothecium size shown in (C) (***p < 0.001).

Role of FkhB in A. nidulans Conidia

As the mRNA level of fkhB was higher in conidia (Fig. S1), we investigated the role of FkhB in conidia. To test this, we assessed conidium viability, trehalose content, and thermal stress tolerance. Trehalose is a key stress protectant [32] in conidia, and the trehalose content in the ΔfkhB conidia was lower than that of the control or complemented conidia (Fig. 4A). We then investigated the thermal stress tolerance in the ΔfkhB conidia and found that the ΔfkhB conidia were more sensitive to thermal stress (Fig. 4B). These findings suggest that FkhB is required for correct trehalose content and heat stress tolerance of A. nidulans conidia.

Figure 4. The role of FkhB in conidia. (A) The amount of trehalose per 10⁸ conidia from 2-day culture of control (TNJ36), ΔfkhB (TSY7.2), and C’ fkhB (TSY9.1) (**p < 0.01). (B) Thermal stress tolerance of conidia from control (TNJ36), ΔfkhB (TSY7.2), and C’ fkhB (TSY9.1) strains. Approximately 100 conidia were incubated at 50°C for 0, 15, and 30 min and spread onto solid MM (**p < 0.01, *p < 0.05).

Forkhead transcription factors are key regulators that control development, cell cycle, morphogenesis, and stress response in fungi and yeast [15, 33, 34]. Three of the six forkhead genes in A. nidulans have been studied [20-22], showing that FkhA only affects sexual reproduction while FkhE and FkhF are involved in asexual development. Our study found that the absence of fkhB caused the formation of abnormal sexual and sexual development. Collectively, our results suggest that the forkhead regulators play a key role in fungal development.

The forkhead proteins are DNA-binding transcription factors that regulate the expression level of specific genes associated with development. FkhB contains two domains, the forkhead domain and forkhead-associated domain, which are important for DNA-binding and origin selection in yeast, respectively [35, 36]. Although we could not find a putative nuclear localization signal through bioinformatic analysis, the red fluorescent protein (RFP) tagging approach identified that the FkhB-RFP fusion protein was localized in the nucleus (Fig. S2). This result suggests that FkhB may play a role as a transcription factor, and therefore the target and DNA-binding motif of FkhB should be revealed through additional research.

The forkhead proteins in filamentous fungi are also involved in secondary metabolism [37]. For example, AcFKH1 is necessary for arthrospore formation and cephalosporin biosynthesis in Acremonium chrysogenum [38, 39]. In Penicillium chrysogenum, PcRFX1 affects penicillin biosynthesis [40]. In A. nidulans, the ΔfkhB strain produced reduced amounts of sterigmatocystin compared with that of the control strain (Fig. S3). Thus, several of the forkhead regulators are involved in both fungal morphogenesis and metabolism in filamentous fungi.

In summary, we studied the fkhB gene predicted to encode a forkhead transcription factors in A. nidulans. FkhB affected fungal growth and the formation of sexual fruiting bodies. FkhB is also involved in trehalose biosynthesis and thermal tolerance of A. nidulans conidia but did not affect the production of sterigmatocystin. Our study indicates that FkhB plays a pivotal role in growth, development, and conidial cellular maturation in A. nidulans.

This work was supported by the National Research Foundation of Korea (NRF) grant to HSP funded by the Korean government (NRF-2020R1C1C1004473) and a project to train professional personnel in biological materials by the Ministry of Environment. The work at UW-Madison was supported by Food Research Institute at the University of Wisconsin-Madison.

The authors have no financial conflicts of interest to declare.