전체메뉴
검색
Article Search

JMB Journal of Microbiolog and Biotechnology

QR Code QR Code

Research article


References

  1. Chen H, McGowan EM, Ren N, Lal S, Nassif N, Shad-Kaneez F, et al. 2018. Nattokinase: a promising alternative in prevention and treatment of cardiovascular diseases. Biomark. Insights 13: 117271918785130.
    Pubmed PMC CrossRef
  2. Omura K, Hitosugi M, Zhu X, Ikeda M, Maeda H, Tokudome S. 2005. A newly derived protein from Bacillus subtilis natto with both antithrombotic and fibrinolytic effects. J. Pharmacol. Sci. 99: 247-251.
    Pubmed CrossRef
  3. Cai D, Zhu C, Chen S. 2017. Microbial production of nattokinase: current progress, challenge and prospect. World J. Microbiol. Biotechnol. 33: 84.
    Pubmed CrossRef
  4. Agrebi R, Haddar A, Hajji M, Frikha F, Manni L, Jellouli K, et al. 2009. Fibrinolytic enzymes from a newly isolated marine bacterium Bacillus subtilis A26: characterization and statistical media optimization. Can. J. Microbiol. 55: 1049-1061.
    Pubmed CrossRef
  5. Man LL, Xiang DJ, Zhang CL. 2019. Strain screening from traditional fermented soybean foods and induction of nattokinase production in Bacillus subtilis MX-6. Probiotics Antimicrob. Proteins 11: 283-294.
    Pubmed CrossRef
  6. Kwon EY, Kim KM, Kim MK, Lee IY, Kim BS. 2011. Production of nattokinase by high cell density fed-batch culture of Bacillus subtilis. Bioprocess Biosyst. Eng. 34: 789-793.
    Pubmed CrossRef
  7. Unrean P, Nguyen NHA. 2013. Metabolic pathway analysis and kinetic studies for production of nattokinase in Bacillus subtilis. Bioprocess Biosyst. Eng. 36: 45-56.
    Pubmed CrossRef
  8. Chen PT, Shaw JF, Chao YP, Ho THD, Yu SM. 2010. Construction of chromosomally located T7 expression system for production of heterologous secreted proteins in Bacillus subtilis. J. Agric. Food Chem. 58: 5392-5399.
    Pubmed CrossRef
  9. Jeong SJ, Park JY, Lee JY, Lee KW, Cho KM, Kim GM, et al. 2015. Improvement of fibrinolytic activity of Bacillus subtilis 168 by integration of a fibrinolytic gene into the chromosome. J. Microbiol. Biotechnol. 25: 1863-1870.
    Pubmed CrossRef
  10. Cai Y, Bao W, Jiang S, Weng M, Jia Y, Yin Y, et al. 2011. Directed evolution improves the fibrinolytic activity of nattokinase from Bacillus natto. FEMS Microobiol. Lett. 325: 155-161.
    Pubmed CrossRef
  11. Kim J, Kim JH, Choi KH, Kim JH, Song YS, Cha J. 2011. Enhancement of the catalytic activity of a 27 kDa subtilisin-like enzyme from Bacillus amyloliquefaciens CH51 by in vitro mutagenesis. J. Agric. Food Chem. 59: 8675-8682.
    Pubmed CrossRef
  12. Liu Z, Zheng W, Ge C, Cui W, Zhou L, Zhou Z. 2019. High-level extracellular production of recombinant nattokinase in Bacillus subtilis WB800 by multiple tandem promoters. BMC Microbiol. 19: 89.
    Pubmed PMC CrossRef
  13. Jeong SJ, Kwon GH, Chun JY, Kim JS, Park CS, Kwon DY, et al. 2007. Cloning of fibrinolytic enzyme gene from Bacillus subtilis isolated from Cheonggukjang and its expression in protease-deficient Bacillus subtilis strains. J. Microbiol. Biotechnol. 17: 1018-1023.
  14. Haldenwang WG. 1995. The sigma factors of Bacillus subtilis. Microbiol. Rev. 59: 1-30.
    Pubmed PMC CrossRef
  15. Cheng J, Guan C, Cui W, Zhou L, Liu Z, Li W, et al. 2016. Enhancement of a high efficient autoinducible expression system in Bacillus subtilis by promoter engineering. Protein Expr. Purif. 127: 81-87.
    Pubmed CrossRef
  16. Jan J, Valle F, Bolivar F, Merino E. 2001. Construction of protein overproducer strains in Bacillus subtilis by an integrative approach. Appl. Microbiol. Biotechnol. 55: 69-75.
    Pubmed CrossRef
  17. Han LC, Suo FY, Jiang C, Gu J, Li NN, Zhang NX, et al. 2017. Fabrication and characterization of a robust and strong bacterial promoter from a semi-rationally engineered promoter library in Bacillus subtilis. Process Biochem. 61: 56-62.
    CrossRef
  18. Wu XC, Lee W, Tran L, Wong SL. 1991. Engineering a Bacillus subtilis expression-secretion system with a strain deficient in six extracellular proteases. J. Bacteriol. 173: 4952-4958.
    Pubmed PMC CrossRef
  19. Sambrook J, Russell DW. 2001. Molecular cloning: a laboratory manual, 3rd Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA.
  20. Yao Z, Liu X, Shim JM, Lee KW, Kim HJ, Kim JH. 2017. Properties of a fibrinolytic enzyme secreted by Bacillus amyloliquefaciens RSB34, isolated from doenjang. J. Microbiol. Biotechnol. 27: 9-18.
    Pubmed CrossRef
  21. Meng L, Feldman L. 2010. A rapid TRIzol-based two-step method for DNA-free RNA extraction from Arabidopsis siliques and dry seeds. Biotechnol. J. 5: 183-186.
    Pubmed CrossRef
  22. Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods 25: 402-408.
    Pubmed CrossRef
  23. Miyazaki K. 2011. MEGAWHOP cloning: a method of creating random mutagenesis libraries via megaprimer PCR of whole plasmids. Methods Enzymol. 498: 399-406.
  24. Lee SJ, Pan JG, Park SH, Choi SK. 2010. Development of a stationary phase-specific autoinducible expression system in Bacillus subtilis. J. Biotechnol. 149: 16-20.
    Pubmed CrossRef
  25. Choi NS, Yoo KH, Yoon KS, Chang KT, Maeng PJ, Kim SH. 2005. Identification of recombinant subtilisins. J. Microbiol. Biotechnol. 15: 35-39.
  26. Chen J, Gai Y, Fu G, Zhou W, Zhang D, Wen J. 2015. Enhanced extracellular production of a-amylase in Bacillus subtilis by optimization of regulatory elements and over-expression of PrsA lipoprotein. Biotechnol. Lett. 37: 899-906.
    Pubmed CrossRef

Related articles in JMB

More Related Articles

Article

Research article

J. Microbiol. Biotechnol. 2021; 31(6): 833-839

Published online June 28, 2021 https://doi.org/10.4014/jmb.2103.03027

Copyright © The Korean Society for Microbiology and Biotechnology.

Increase of a Fibrinolytic Enzyme Production through Promoter Replacement of aprE3-5 from Bacillus subtilis CH3-5

Zhuang Yao1, Yu Meng1, Huong Giang Le1, Se Jin Lee1, Hye Sung Jeon1, Ji Yeon Yoo1, and Jeong Hwan Kim1,2*

1Division of Applied Life Science (BK21 Four), Graduate School, Gyeongsang National University, Jinju 52828, Republic of Korea
2Institute of Agriculture and Life Science, Gyeongsang National University, Jinju 52828, Republic of Korea

Correspondence to:Jeong Hwan Kim,     jeonghkm@gsnu.ac.kr

Received: March 15, 2021; Revised: May 3, 2021; Accepted: May 6, 2021

Abstract

Bacillus subtilis CH3-5 isolated from cheonggukjang secretes a 28 kDa protease with a strong fibrinolytic activity. Its gene, aprE3-5, was cloned and expressed in a heterologous host (Jeong et al., 2007). In this study, the promoter of aprE3-5 was replaced with other stronger promoters (Pcry3A, P10, PSG1, PsrfA) of Bacillus spp. using PCR. The constructed chimeric genes were cloned into pHY300PLK vector, and then introduced into B. subtilis WB600. The P10 promoter conferred the highest fibrinolytic activity, i.e., 1.7-fold higher than that conferred by the original promoter. Overproduction of the 28 kDa protease was confirmed using SDS-PAGE and fibrin zymography. RT-qPCR analysis showed that aprE3-5 expression was 2.0-fold higher with the P10 promoter than with the original promoter. Change of the initiation codon from GTG to ATG further increased the fibrinolytic activity. The highest aprE3-5 expression was observed when two copies of the P10 promoter were placed in tandem upstream of the ATG initiation codon. The construct with P10 promoter and ATG and the construct with two copies of P10 promoter in tandem and ATG exhibited 117% and 148% higher fibrinolytic activity, respectively, than that exhibited by the construct containing P10 promoter and GTG. These results confirmed that significant overproduction of a fibrinolytic enzyme can be achieved by suitable promoter modification, and this approach may have applications in the industrial production of AprE3-5 and related fibrinolytic enzymes.

Keywords: Bacillus subtilis, promoter replacement, gene expression, fibrinolytic enzymes

Introduction

Fibrinolytic enzymes secreted by some Bacillus spp. have been the subject of many researches owing to their application as potential anti-thrombotic agents [1, 2]. Nattokinase is the most well-known enzyme, and commercially sold as a neutraceutical supplement. The overproduction of fibrinolytic enzymes, such as nattokinase, is important for the development of various products that contain them. To achieve this goal, various methods have been tried including screening of novel strains with strong fibrinolytic activities [3-5], optimizing the cultural conditions [6, 7], construction of host strains where fibrinolytic genes were integrated into the chromosome [8, 9], and improvements of fibrinolytic genes through in vitro mutagenesis [10, 11]. One of the most efficient methods for increasing gene expression is the replacement of the original promoter with a known stronger promoter because an increase in the transcription frequency results in an increase in the production of gene products [12].

Previously, we cloned a gene (aprE3-5) encoding the major fibrinolytic enzyme of B. subtilis CH3-5, which was isolated from cheonggukjang, Korean fermented soybean food. aprE3-5 encodes a preproenzyme that yields a mature 28 kDa enzyme. aprE3-5 was expressed in a heterologous host, B. subtilis WB600 [13]. In this study, we constructed chimeric aprE3-5 genes, wherein the original promoter was replaced with one of the four known strong Bacillus spp. promoters. Furthermore, we constructed aprE genes wherein the initiation codon was changed from GTG to ATG and two copies of the most efficient promoter, i.e., P10, were placed in tandem upstream of the ATG initiation codon. We found that promoter replacement along with other modifications were effective in achieving the overproduction of AprE3-5 and in increasing the fibrinolytic activity of the host cell.

Materials and Methods

Construction of aprE3-5 Genes with Its Promoter Replaced with Other Promoter

Primers were designed to amplify aprE3-5 with its -35 and -10 promoter sequences were replaced with those from other Bacillus promoters (Table 1). PCR reactions were performed using a MJ mini personal thermal cycler (Bio-Rad, USA). pHY3-5 (pHY300PLK containing aprE3-5) was used as the template DNA [13]. The reaction mixture (50 μl) consisted of 1 μl of template DNA, 1 μl of each primer (10 μM), 5 μl of dNTPs (0.25 mM), and 0.5 μl of ExTaq DNA polymerase (Takara, Japan). Amplification conditions were as follows: 94°C for 5 min, 30 cycles of 94°C for 30 s, 64°C for 30 s, 72°C for 40 s, and a final extension at 72°C for 5 min.

Table 1 . Primers used in this study..

PrimersSequencesReferences
Restriction site -35 -10
aprE3-5-F5’-CGCGGATCCGGGTCTACTAAAATATTATTCCATCTATTACAATAAATTC -3’13
Pcry3A-F5’-CGCGGATCCGGGTTGCAAAAAATATTATTCCATCTATTAAGCTAAATTC -3’14
P10-F5’-CGCGGATCCGGGTTGACAAAAATATTATTCCATCTATTAAACTAAATTC -3’15
PSG1-F5’-CGCGGATCCGGGTTGACAAAAATATTATTCCATCTATTACAATAAATTC -3’16
PsrfA-F5’-CGCGGATCCGGGGTGATAAAAATATTATTCCATCTATTAAACTAAATTC -3’17
aprE3-5-R5'- GCGAATTCGAGAACAGAGAAGCCGCT -3'13

The restriction site was underlined: BamHI (forward primer) and EcoRI (reverse primer).The -35 and -10 promoter regions were in bold and underlined..



Introduction of Chimeric aprE3-5 Genes into B. subtilis WB600

Amplified DNA was digested with BamHI and EcoRI, and ligated with pHY300PLK (4.87 kb, ApR, TcR), an E. coli-Bacillus shuttle vector. The ligation mixture was used to transform B. subtilis WB600 competent cells [18]. Preparation of B. subtilis WB600 competent cells and electroporation (200 Ω, 21 kV/cm) were done as reported previously [13]. Transformants (TFs) on LB agar plates with tetracycline (15 µg/ml) were screened for the recombinant plasmids. Plasmid DNA was prepared by using commercial kit (iNtRON Biotechnology, Korea), and DNA sequencing was done. Restriction enzyme digestion and agarose gel electrophoresis were performed according to the standard methods [19].

Growth and Fibrinolytic Activities of B. subtilis TFs

B. subtilis TFs were cultivated in LB broth with tetracycline (15 µg/ml) at 37°C with shaking. Aliquots were taken at 12 h intervals, and the OD600 values were measured. Culture was centrifuged at 4,000 ×g for 10 min at 4°C and the supernatant was used as a crude sample for fibrinolytic activity measurement. Fibrinolytic activity was measured by the fibrin plate method as described previously [20].

SDS-PAGE and Fibrin Zymography

Supernatants obtained as above were analyzed by SDS-PAGE and fibrin zymography. For SDS-PAGE, proteins (10 µg) in the supernatant was concentrated by TCA precipitation, and loaded onto a 10% acrylamide gel after boiled for 10 min in 4 X SDS sample buffer. For fibrin zymography, supernatant (1 µg) was loaded without TCA concentration. Fibrin gel preparation and fibrin zymography were done as described previously [20]. The Dokdo-marker (EBM-1034, Elpis-Biotech., Korea) was used as the size marker.

Reverse Transcription (RT)-qPCR Analysis

RNA was prepared from 48 h culture of B. subtilis WB600 TF by using Trizol/bead method [21], and treated with RQ1 RNase-free DNase (Promega, USA). RT-PCR was done using one-step RT-PCR premix kit (iNtRON Biotechnology, Korea). aprE3-5 was amplified by using primer pair in Table 2. The 20 μl reaction mixture consisted of 8 μl of premix, each 1 μl of forward and reverse primer, 1 μl of RNA (200 ng), and 9 μl of DEPC-treated water. The reaction was started by 30 min incubation at 45°C, followed by initial denaturation at 94°C for 5 min. PCR cycles consisted of denaturation at 94°C for 1 min, annealing at 53°C for 1 min, and extension at 72°C for 1 min. A total of 25 cycles were repeated, and the final extension was done at 72°C for 5 min. 16S rRNA gene was used as a control, and primer pair 27F and 1492R were used for the amplification. PCR results were checked by agarose gel electrophoresis using a 1% gel and iVDye 1kb DNA Ladder (GenDepot, USA) as a size marker.

Table 2 . Primers used for reverse transcription PCR..

PCR reactionGenes namePrimer pairsSequencesExpected size
RT-PCRaprE3-5aprE-RT-F
aprE-RT-R
5'-TGGATCAGCTTGTTGTTTGCG-3'
5'-GGGTGCTTAGAAAGGATTAGC-3'
1 kb
16S rRNA27F
1492R
5'-AGAGTTTGATCCTGGCTCAG-3'
5'-GGTTACCTTGTTACGACTT-3'
1.5 kb
qRT-PCRaprE3-5aprE-qRT-F
aprE-qRT-R
5'-AACAGCAGCAACCAAAGAGC-3'
5'-TCGGGTGCTTAGAAAGGAT-3'
178 bp
16S rRNA16S-qRT-F
16S-qRT-R
5'-GAGTGACAGCTGGTGCATGGT-3'
5'-TTGTCACCGGCAGTCACCTTA-3'
160 bp


Quantitative real-time PCR was done using the reverse transcription PCR products as the templates. qPCR reactions were performed by using primer pairs in Table 2, and the reaction mixture consisted of 10 μl of SYBR-Green mix (Bio-Rad, USA), 1 μl of each primer, 7 μl of distilled water, and 1 μl of 200-fold diluted cDNA product. The reactions were carried out using an instrument (CFX96, Bio-Rad). The relative gene expression was calculated by quantification cycle (Cq) value with the 2−ΔΔCT method [22]. The 16S rRNA gene was used as a control, and all reactions were repeated 3 times.

Construction of an aprE3-5 with 2 Copies of P10 Promoter in Tandem

The primer pairs in Table 3 were used to construct an aprE3-5 containing 2 copies of P10 promoter in tandem. An aprE3-5 without its promoter was amplified from plasmid pHY3-5 by PCR using aprE3-5-np-F and aprE3-5-R primers, and the start codon was replaced from 'GTG' to 'ATG'. The reaction mixture (50 μl) consisted of 1 μl of template DNA, 1 μl of each primer (10 μM), 5 μl of dNTPs (0.25 mM), and 0.5 μl of ExTaq DNA polymerase (Takara, Tokyo, Japan). Amplification conditions were as follows: 94°C for 5 min, 30 cycles of 94°C for 30 s, 64°C for 30 s, 72°C for 40 s, and a final extension at 72°C for 5 min. The purified DNA and pHY300PLK were digested with BamHI and EcoRI and ligated by T4 DNA ligase. The ligation mixture was used to transform E. coli DH5α competent cells, and the recombinant plasmid, pHYnpE2, without a promoter was obtained.

Table 3 . Primers used for construction of an aprE with tandem P10 promoter..

PrimersSequencesReferences
aprE3-5-np-F5’-CTGGATCCTCTTAAAAGGAGAGGGTAAAGAATGAGAAGCA-3’’This study
aprE3-5-R5'- GCGAATTCGAGAACAGAGAAGCCGCT -3'13
MagaP10-F5’-AAGCTTCTAGAGATCTGCAGGTCGACGGGTTGACAAAAATATTATTCCATCTATTAAACTAAATTCACAGAATAGTCTTT -3’This study
MagaP10-R5’-TTTTAAGAGGATCCAGAGTAGACTTACTTAAAAGACTATTCTGTGAATTTAGTTTAATAGATGGAATAATATTTTTGTC -3’This study
Maga2P10-F5’-GGCGGAGCCTATGGAAAAACGCTTTGCCCTTGACAAAAATATTATTCCATCTATTAAACTAAGCTT -3’This study
Maga2P10-R5’-CCCGTCGACCTGCAGATCTCTAGAAGCTTAGTTTAATAGATGGAATAATATTTTTGTCAAGGGCAA-3’This study

The restriction site was underlined: BamHI (forward primer) and EcoRI (reverse primer).The -35 and -10 promoter regions were in bold and underlined..



Following the Megawhop protocol [23], the P10 promoter was cloned into the upstream of aprE3-5 in pHYnpE2 using MegaP10-F and MegaP10-R primers. The PCR product was digested with DpnI, and the resulting plasmid was introduced into E. coli DH5α to obtain the plasmid pHYP10E2. Then, another P10 promoter was cloned into the pHYP10E2 using Mega2P10-F and Mega2P10-R primers. The PCR product was digested with DpnI, and the resulting plasmid was introduced into E. coli DH5α to obtain the plasmid pHY2P10E2. pHYP10E2 and pHY2P10E2 were introduced into B. subtilis WB600 competent cells, respectively. The fibrinolytic activity assay, SDS-PAGE, and fibrin zymography were done to check the effect of tandem P10 promoters on the expression of aprE3-5.

Results and Discussion

Construction of aprE3-5 Genes with Its Promoter Replaced with Other Promoter

To increase the expression level of aprE3-5 in a heterologous Bacillus host, the -35 and -10 promoter sequences of aprE3-5 (PaprE3-5) were replaced with other strong Bacillus promoters without changes in the intervening sequences (Table 1). Pcry3Aa is a promoter modified from cry promoter of B. thuringiensis where the promoter is responsible for the overproduction of crystal proteins (Cry) [24]. The original -35 and -10 sequences of cry promoter were replaced with the consensus sequences of σA- dependent promoter of B. subtilis, generating Pcry3Aa [14]. P10 promoter was derived from quorum sensing related promoter PsrfA where the -35 sequence (GTGATA) was changed into the conserved sequence (TTGACA) [15]. PSG1 (same with PSG-TTGACA in the ref. 16) was derived from PSG35.1 where the -35 sequence (TACTAA) was replaced with the consensus sequence (TTGACA) [16]. PsrfA, has the same -35 (GTGATA) and -10 sequences (TAAACT) of promoter of srfA [17]. These promoters were chosen because they do not require any specific inducer, which is expensive for large-scale cultivation and inconvenient, too.

Chimeric aprE3-5 genes with the replaced -35 and -10 sequences were amplified by PCR (data not shown), and ligated with pHY300PLK. B. subtilis WB600 TFs harboring recombinant plasmids were obtained. DNA sequencing confirmed that the replaced -35 and -10 promoter sequences were connected to the 1,146 bp aprE3-5 structural gene as expected (data not shown).

Growth and Fibrinolytic Activities of B. subtilis WB600 TFs

B. subtilis WB600 TFs harboring different plasmid constructs (original aprE3-5 gene and 4 chimeric genes) were inoculated into LB broth and cultured with shaking at 37°C for 96 h. All strains grew well and OD600 values reached 1.5-1.7 after 24 h incubation, and the growth curve of each strain was similar (Fig. 1A). Culture carrying PaprE3-5 showed fibrinolytic activity (FA) of 369.96 U/ml at 96 h of incubation whereas those of culture carrying Pcry3A, PsrfA, P10, or PSG1 were 376.22, 460.85, 628.15, or 490.23 U/ml, respectively (Fig. 1B). Except the strain carrying Pcry3Aa, other strains showed significantly higher activities than the strain carrying the original promoter. The strain carrying P10 promoter showed the highest activity (628.15 U/ml), and the activity was 1.7 fold higher than that of the original strain (369.96 U/ml) at 96 h time point. The strain carrying PSG1 showed 1.3 fold higher activity. All strains showed similar pattern in fibrinolytic activity changes during the 96 h of incubation. The activities increased rapidly during the first 36 h, and then increased gradually. The highest activities observed between 48 and 60 h. However, the activity increased continuously until 96 h in the strain carrying pHYP10 (pHY300PLK with P10 promoter).

Figure 1. Growth (A) and fibrinolytic activities (B) of B. subtilis WB600 TFs. B. subtilis TFs were cultivated for 96 h at 37°C in LB broth and the growth (OD600) and fibrinolytic activities were measured at 12 h intervals. -●-, B. subtilis WB600 [pHY3-5]; -○-, B. subtilis WB600 [pHYsrfA]; -▼-, B. subtilis WB600 [pHYP10]; -△-, B. subtilis WB600 [pHYPSG]; -■-, B. subtilis WB600 [pHYPcry3A].

SDS-PAGE and Fibrin Zymography

Supernatant samples prepared at 48 h and 96 h were analyzed by SDS-PAGE and fibrin zymography using 10%acrylamide gels (Fig. 2). Four bands of 24, 28, 38 and 60 kDa in size were observed on a coomassie blue stained gel (Fig. 2A) and one band (28 kDa) was detected on a fibrin gel (Fig. 2B). The 28 kDa protein was the mature form of AprE3-5. Culture carrying P10 promoter showed the strongest band intensity for 28 kDa protein (Fig. 2A, lanes 7, 8). The results indicated that AprE3-5 was overproduced from P10 promoter compared to other promoters. Similarly, the top regions of lanes 7 and 8 showed larger transparent areas than others. The big transparent region was suspected to be caused by binding of fibrinolytic enzymes to fibrin in the gel [25], and the size reflects the amount of the fibrinolytic enzymes in the sample. These results were consistent with the fibrinolytic activities of cultures (Fig. 1B).

Figure 2. Coomassie blue stained gel (A) and fibrin zymogram (B) of culture supernatant from B. subtilis WB600 TFs. M, Dokdo-marker (EBM-1034); lane 1, B. subtilis WB600 [pHY3-5] at 48 h; 2, at 96 h; 3, B. subtilis WB600 [pHYPsrfA] at 48 h; 4, at 96 h; 5, B. subtilis WB600 [pHYPSG] at 48 h; 6, at 96 h; 7, B. subtilis WB600 [pHYP10] at 48 h; 8, at 96 h.

Reverse Transcription-qPCR Analysis

RT-PCR was performed with RNA samples to confirm the aprE3-5 mRNA content in different samples. The expected amplified size of aprE3-5 was 1 kb. The amplified size of 16S rRNA gene was 1.5 kb. Agarose gel electrophoresis results confirmed 2 cDNA fragments with the matching sizes (Fig. 3A). The cDNA fragments in lane 1 and 2 were amplified aprE3-5, around 1 kb, and the cDNA fragments in lane 3 and 4 were amplified 16S rRNA gene, around 1.5 kb. The results showed that the concentration of aprE3-5 mRNA from the P10 carrying strain (lane 2) was significantly higher than that from the original strain (lane 1). The 16S rRNA gene concentrations were the same. The results showed qualitatively that the P10 promoter increased the frequency of transcription of aprE3-5.

Figure 3. Reverse Transcription (RT)-PCR (A) and the relative expression levels of aprE3-5 by its own promoter and replaced P10 promoter (B). M, iVDye 1kb DNA Ladder; 1-2, aprE3-5, RT-PCR product of B. subtilis WB600 [pHY3- 5] (lane 1), and B. subtilis WB600 [pHYP10] (lane 2); 3-4, 16S rRNA gene, RT-PCR product of B. subtilis WB600 [pHY3-5] (lane 3), and B. subtilis WB600 [pHYP10] (lane 4).

Quantitative real-time PCR analysis was performed using the reverse transcription product as template to quantitatively analyze the effect by P10 promoter. Using 16S rRNA gene as a control, the relative expression level of aprE3-5 was calculated using the 2−ΔΔCT method. The expression level of original strain was set to 1. The expression of aprE3-5 gene by P10 promoter was significantly increased. At 48 h of incubation, the expression level was 2.01-fold higher than that by the original promoter (Fig. 3B). The fibrinolytic activity of strain carrying PaprE3-5 or P10 was 375.15 U/ml and 579.33 U/ml, respectively at 48 h of incubation. The strain carrying P10 promoter showed 1.54 fold higher fibrinolytic activity than that from the strain carrying the original promoter. The difference in gene expression matched with the fibrinolytic activities of cultures.

The -35 sequence of P10 was TTGACA, identical with the consensus -35 sequence whereas that of the original aprE3-5 promoter is TCTACT. The -10 sequence of original aprE3-5 promoter and P10 are TACAAT and TAAACT, respectively. The -10 consensus sequence is TATAAT. Therefore the -10 sequence of original aprE3-5 promoter is more conserved than that of P10, and the results indicated that -35 sequence might contribute more to the overall promoter strength. Overproduction of valuable metabolites such as fibrinolytic enzymes can be achieved by many different methods, and the replacement of original promoter with stronger promoter is one option, which can be applied quickly and easily.

Construction of aprE3-5 with 2 Copies of P10 Promoter in Tandem

Bacillus strains harboring pHYP10, pHYP10E2, pHY2P10E2, or pHY300PLK (negative control), were obtained (Fig. 4), and cultivated in LB broth. Growth and fibrinolytic activities were measured (Fig. 5). All strains grew well, and showed the same absorbance values (600 nm) at 96 h (Fig. 5A). B. subtilis WB600 carrying pHY2P10E2 showed the highest fibrinolytic activity (624.6 mU/μl) at 96 h (Fig. 5B). Cells carrying pHYP10E2 was the next, 495.0 mU/μl. Cells carrying pHY10 showed the activity of 423.3 mU/ml. The activity of the strain carrying pHYP10E2 (ATG start codon) was 117% higher than that of the strain carrying pHYP10, indicating that ATG was better than GTG for gene expression. The activity of the strain carrying pHY2P10E2 was 148% higher than that of the strain carrying pHYP10. The results indicated that 2 copies of P10 promoter in tandem further improved the gene expression level of aprE3-5 in B. subtilis.

Figure 4. The schematic diagram of the expression cassettes. pHYP10, pHY300PLK containing the aprE3-5 where the original promoter was replaced with -35 and -10 sequences from P10 promoter. pHYP10E2, pHYP10 where the start codon was changed from GTG to ATG. pHY2P10E2, pHYP10E2 where an additional P10 promoter was placed in tandem.

Figure 5. Growth (A) and fibrinolytic activities (B) of B. subtilis WB600 TFs. B. subtilis TFs were cultivated for 96 h at 37°C in LB broth and the growth (OD600) and fibrinolytic activities were measured at 12 h intervals. -●-, B. subtilis WB600 [pHYP10]; -○-, B. subtilis WB600 [pHYP10E2]; -▼-, B. subtilis WB600 [pHY2P10E2]; -△-, B. subtilis WB600 [pHY300PLK].

SDS-PAGE and fibrin zymography were done for culture supernatants obtained at 12 h and 96 h. Four bands of 24, 28, 38, and 60 kDa were observed on the gel stained with coomassie brilliant blue (Fig. 6A). The 28 kDa band was the most obvious, indicating that a large amount of AprE3-5 was produced. On the fibrin zymogram (Fig. 6B), the size of transparent zone at the top of a fibrin gel reflected the fibrinolytic activity of a sample. The sizes of the transparent areas at the top of lanes 1, 3, and 5 were similar with each other, indicating that the activity difference between samples at 12 h was not significant. But the bands with a size of 28 kDa were observed at 96 h samples (lane 2, 4, and 6), indicating that AprE3-5 production occurred at late growth phase or early stationary phase. Especially the clear zone of lane 6 was the largest, indicating that pHY2P10E2 conferred the highest fibrinolytic activity to B. subtilis host. More directly, the band intensity of the 28 kDa protein was the strongest in lane 6, 96 h sample from B. subtilis carrying pHY2P10E2. The results were consistent with the fibrinolytic activity measurements of the cultures (Fig. 5B).

Figure 6. Coomassie blue stained gel (A) and fibrin zymogram (B) of culture supernatant from B. subtilis WB600 TFs. M, Dokdo-marker (EBM-1034); lane 1, B. subtilis WB600 [pHYP10] at 12 h; 2, at 96 h; 3, B. subtilis WB600 [pHYP10E2] at 12 h; 4, at 96 h; 5, B. subtilis WB600 [pHY2P10E2] at 12 h; 6, at 96 h; 7, B. subtilis WB600 [pHY300PLK] at 12 h; 8, at 96 h.

We successfully showed that the tandem P10 promoter increased the production of AprE3-5. In order to increase the production of AprE3-5 even further, it is necessary to conduct more researches on other elements which also might be important for overproduction of AprE3-5. These include the optimization of Shine-Dalgarno sequence, adjustments of the length of intervening sequence between -35 and -10 promoter sequences, and the use of transcription terminator [26]. Further studies are necessary on these topics in addition to optimization in media composition and cultural conditions.

Acknowledgments

This work was supported by the Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education (2017R1D1A1B03030037) and also by a NRF grant funded by the Korea government (MSIT) (NRF-2020R1A2C100826711). Yao Z, Meng Y, Lee SJ, Jeon HS, and Yoo JY were supported by BK21 program, MOE, Republic of Korea. Le HG was supported by full time graduate student scholarship from Gyeongsang National University.

Conflict of Interest


The authors have no financial conflicts of interest to declare.

Fig 1.

Figure 1.Growth (A) and fibrinolytic activities (B) of B. subtilis WB600 TFs. B. subtilis TFs were cultivated for 96 h at 37°C in LB broth and the growth (OD600) and fibrinolytic activities were measured at 12 h intervals. -●-, B. subtilis WB600 [pHY3-5]; -○-, B. subtilis WB600 [pHYsrfA]; -▼-, B. subtilis WB600 [pHYP10]; -△-, B. subtilis WB600 [pHYPSG]; -■-, B. subtilis WB600 [pHYPcry3A].
Journal of Microbiology and Biotechnology 2021; 31: 833-839https://doi.org/10.4014/jmb.2103.03027

Fig 2.

Figure 2.Coomassie blue stained gel (A) and fibrin zymogram (B) of culture supernatant from B. subtilis WB600 TFs. M, Dokdo-marker (EBM-1034); lane 1, B. subtilis WB600 [pHY3-5] at 48 h; 2, at 96 h; 3, B. subtilis WB600 [pHYPsrfA] at 48 h; 4, at 96 h; 5, B. subtilis WB600 [pHYPSG] at 48 h; 6, at 96 h; 7, B. subtilis WB600 [pHYP10] at 48 h; 8, at 96 h.
Journal of Microbiology and Biotechnology 2021; 31: 833-839https://doi.org/10.4014/jmb.2103.03027

Fig 3.

Figure 3.Reverse Transcription (RT)-PCR (A) and the relative expression levels of aprE3-5 by its own promoter and replaced P10 promoter (B). M, iVDye 1kb DNA Ladder; 1-2, aprE3-5, RT-PCR product of B. subtilis WB600 [pHY3- 5] (lane 1), and B. subtilis WB600 [pHYP10] (lane 2); 3-4, 16S rRNA gene, RT-PCR product of B. subtilis WB600 [pHY3-5] (lane 3), and B. subtilis WB600 [pHYP10] (lane 4).
Journal of Microbiology and Biotechnology 2021; 31: 833-839https://doi.org/10.4014/jmb.2103.03027

Fig 4.

Figure 4.The schematic diagram of the expression cassettes. pHYP10, pHY300PLK containing the aprE3-5 where the original promoter was replaced with -35 and -10 sequences from P10 promoter. pHYP10E2, pHYP10 where the start codon was changed from GTG to ATG. pHY2P10E2, pHYP10E2 where an additional P10 promoter was placed in tandem.
Journal of Microbiology and Biotechnology 2021; 31: 833-839https://doi.org/10.4014/jmb.2103.03027

Fig 5.

Figure 5.Growth (A) and fibrinolytic activities (B) of B. subtilis WB600 TFs. B. subtilis TFs were cultivated for 96 h at 37°C in LB broth and the growth (OD600) and fibrinolytic activities were measured at 12 h intervals. -●-, B. subtilis WB600 [pHYP10]; -○-, B. subtilis WB600 [pHYP10E2]; -▼-, B. subtilis WB600 [pHY2P10E2]; -△-, B. subtilis WB600 [pHY300PLK].
Journal of Microbiology and Biotechnology 2021; 31: 833-839https://doi.org/10.4014/jmb.2103.03027

Fig 6.

Figure 6.Coomassie blue stained gel (A) and fibrin zymogram (B) of culture supernatant from B. subtilis WB600 TFs. M, Dokdo-marker (EBM-1034); lane 1, B. subtilis WB600 [pHYP10] at 12 h; 2, at 96 h; 3, B. subtilis WB600 [pHYP10E2] at 12 h; 4, at 96 h; 5, B. subtilis WB600 [pHY2P10E2] at 12 h; 6, at 96 h; 7, B. subtilis WB600 [pHY300PLK] at 12 h; 8, at 96 h.
Journal of Microbiology and Biotechnology 2021; 31: 833-839https://doi.org/10.4014/jmb.2103.03027

Table 1 . Primers used in this study..

PrimersSequencesReferences
Restriction site -35 -10
aprE3-5-F5’-CGCGGATCCGGGTCTACTAAAATATTATTCCATCTATTACAATAAATTC -3’13
Pcry3A-F5’-CGCGGATCCGGGTTGCAAAAAATATTATTCCATCTATTAAGCTAAATTC -3’14
P10-F5’-CGCGGATCCGGGTTGACAAAAATATTATTCCATCTATTAAACTAAATTC -3’15
PSG1-F5’-CGCGGATCCGGGTTGACAAAAATATTATTCCATCTATTACAATAAATTC -3’16
PsrfA-F5’-CGCGGATCCGGGGTGATAAAAATATTATTCCATCTATTAAACTAAATTC -3’17
aprE3-5-R5'- GCGAATTCGAGAACAGAGAAGCCGCT -3'13

The restriction site was underlined: BamHI (forward primer) and EcoRI (reverse primer).The -35 and -10 promoter regions were in bold and underlined..


Table 2 . Primers used for reverse transcription PCR..

PCR reactionGenes namePrimer pairsSequencesExpected size
RT-PCRaprE3-5aprE-RT-F
aprE-RT-R
5'-TGGATCAGCTTGTTGTTTGCG-3'
5'-GGGTGCTTAGAAAGGATTAGC-3'
1 kb
16S rRNA27F
1492R
5'-AGAGTTTGATCCTGGCTCAG-3'
5'-GGTTACCTTGTTACGACTT-3'
1.5 kb
qRT-PCRaprE3-5aprE-qRT-F
aprE-qRT-R
5'-AACAGCAGCAACCAAAGAGC-3'
5'-TCGGGTGCTTAGAAAGGAT-3'
178 bp
16S rRNA16S-qRT-F
16S-qRT-R
5'-GAGTGACAGCTGGTGCATGGT-3'
5'-TTGTCACCGGCAGTCACCTTA-3'
160 bp

Table 3 . Primers used for construction of an aprE with tandem P10 promoter..

PrimersSequencesReferences
aprE3-5-np-F5’-CTGGATCCTCTTAAAAGGAGAGGGTAAAGAATGAGAAGCA-3’’This study
aprE3-5-R5'- GCGAATTCGAGAACAGAGAAGCCGCT -3'13
MagaP10-F5’-AAGCTTCTAGAGATCTGCAGGTCGACGGGTTGACAAAAATATTATTCCATCTATTAAACTAAATTCACAGAATAGTCTTT -3’This study
MagaP10-R5’-TTTTAAGAGGATCCAGAGTAGACTTACTTAAAAGACTATTCTGTGAATTTAGTTTAATAGATGGAATAATATTTTTGTC -3’This study
Maga2P10-F5’-GGCGGAGCCTATGGAAAAACGCTTTGCCCTTGACAAAAATATTATTCCATCTATTAAACTAAGCTT -3’This study
Maga2P10-R5’-CCCGTCGACCTGCAGATCTCTAGAAGCTTAGTTTAATAGATGGAATAATATTTTTGTCAAGGGCAA-3’This study

The restriction site was underlined: BamHI (forward primer) and EcoRI (reverse primer).The -35 and -10 promoter regions were in bold and underlined..


References

  1. Chen H, McGowan EM, Ren N, Lal S, Nassif N, Shad-Kaneez F, et al. 2018. Nattokinase: a promising alternative in prevention and treatment of cardiovascular diseases. Biomark. Insights 13: 117271918785130.
    Pubmed KoreaMed CrossRef
  2. Omura K, Hitosugi M, Zhu X, Ikeda M, Maeda H, Tokudome S. 2005. A newly derived protein from Bacillus subtilis natto with both antithrombotic and fibrinolytic effects. J. Pharmacol. Sci. 99: 247-251.
    Pubmed CrossRef
  3. Cai D, Zhu C, Chen S. 2017. Microbial production of nattokinase: current progress, challenge and prospect. World J. Microbiol. Biotechnol. 33: 84.
    Pubmed CrossRef
  4. Agrebi R, Haddar A, Hajji M, Frikha F, Manni L, Jellouli K, et al. 2009. Fibrinolytic enzymes from a newly isolated marine bacterium Bacillus subtilis A26: characterization and statistical media optimization. Can. J. Microbiol. 55: 1049-1061.
    Pubmed CrossRef
  5. Man LL, Xiang DJ, Zhang CL. 2019. Strain screening from traditional fermented soybean foods and induction of nattokinase production in Bacillus subtilis MX-6. Probiotics Antimicrob. Proteins 11: 283-294.
    Pubmed CrossRef
  6. Kwon EY, Kim KM, Kim MK, Lee IY, Kim BS. 2011. Production of nattokinase by high cell density fed-batch culture of Bacillus subtilis. Bioprocess Biosyst. Eng. 34: 789-793.
    Pubmed CrossRef
  7. Unrean P, Nguyen NHA. 2013. Metabolic pathway analysis and kinetic studies for production of nattokinase in Bacillus subtilis. Bioprocess Biosyst. Eng. 36: 45-56.
    Pubmed CrossRef
  8. Chen PT, Shaw JF, Chao YP, Ho THD, Yu SM. 2010. Construction of chromosomally located T7 expression system for production of heterologous secreted proteins in Bacillus subtilis. J. Agric. Food Chem. 58: 5392-5399.
    Pubmed CrossRef
  9. Jeong SJ, Park JY, Lee JY, Lee KW, Cho KM, Kim GM, et al. 2015. Improvement of fibrinolytic activity of Bacillus subtilis 168 by integration of a fibrinolytic gene into the chromosome. J. Microbiol. Biotechnol. 25: 1863-1870.
    Pubmed CrossRef
  10. Cai Y, Bao W, Jiang S, Weng M, Jia Y, Yin Y, et al. 2011. Directed evolution improves the fibrinolytic activity of nattokinase from Bacillus natto. FEMS Microobiol. Lett. 325: 155-161.
    Pubmed CrossRef
  11. Kim J, Kim JH, Choi KH, Kim JH, Song YS, Cha J. 2011. Enhancement of the catalytic activity of a 27 kDa subtilisin-like enzyme from Bacillus amyloliquefaciens CH51 by in vitro mutagenesis. J. Agric. Food Chem. 59: 8675-8682.
    Pubmed CrossRef
  12. Liu Z, Zheng W, Ge C, Cui W, Zhou L, Zhou Z. 2019. High-level extracellular production of recombinant nattokinase in Bacillus subtilis WB800 by multiple tandem promoters. BMC Microbiol. 19: 89.
    Pubmed KoreaMed CrossRef
  13. Jeong SJ, Kwon GH, Chun JY, Kim JS, Park CS, Kwon DY, et al. 2007. Cloning of fibrinolytic enzyme gene from Bacillus subtilis isolated from Cheonggukjang and its expression in protease-deficient Bacillus subtilis strains. J. Microbiol. Biotechnol. 17: 1018-1023.
  14. Haldenwang WG. 1995. The sigma factors of Bacillus subtilis. Microbiol. Rev. 59: 1-30.
    Pubmed KoreaMed CrossRef
  15. Cheng J, Guan C, Cui W, Zhou L, Liu Z, Li W, et al. 2016. Enhancement of a high efficient autoinducible expression system in Bacillus subtilis by promoter engineering. Protein Expr. Purif. 127: 81-87.
    Pubmed CrossRef
  16. Jan J, Valle F, Bolivar F, Merino E. 2001. Construction of protein overproducer strains in Bacillus subtilis by an integrative approach. Appl. Microbiol. Biotechnol. 55: 69-75.
    Pubmed CrossRef
  17. Han LC, Suo FY, Jiang C, Gu J, Li NN, Zhang NX, et al. 2017. Fabrication and characterization of a robust and strong bacterial promoter from a semi-rationally engineered promoter library in Bacillus subtilis. Process Biochem. 61: 56-62.
    CrossRef
  18. Wu XC, Lee W, Tran L, Wong SL. 1991. Engineering a Bacillus subtilis expression-secretion system with a strain deficient in six extracellular proteases. J. Bacteriol. 173: 4952-4958.
    Pubmed KoreaMed CrossRef
  19. Sambrook J, Russell DW. 2001. Molecular cloning: a laboratory manual, 3rd Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA.
  20. Yao Z, Liu X, Shim JM, Lee KW, Kim HJ, Kim JH. 2017. Properties of a fibrinolytic enzyme secreted by Bacillus amyloliquefaciens RSB34, isolated from doenjang. J. Microbiol. Biotechnol. 27: 9-18.
    Pubmed CrossRef
  21. Meng L, Feldman L. 2010. A rapid TRIzol-based two-step method for DNA-free RNA extraction from Arabidopsis siliques and dry seeds. Biotechnol. J. 5: 183-186.
    Pubmed CrossRef
  22. Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods 25: 402-408.
    Pubmed CrossRef
  23. Miyazaki K. 2011. MEGAWHOP cloning: a method of creating random mutagenesis libraries via megaprimer PCR of whole plasmids. Methods Enzymol. 498: 399-406.
  24. Lee SJ, Pan JG, Park SH, Choi SK. 2010. Development of a stationary phase-specific autoinducible expression system in Bacillus subtilis. J. Biotechnol. 149: 16-20.
    Pubmed CrossRef
  25. Choi NS, Yoo KH, Yoon KS, Chang KT, Maeng PJ, Kim SH. 2005. Identification of recombinant subtilisins. J. Microbiol. Biotechnol. 15: 35-39.
  26. Chen J, Gai Y, Fu G, Zhou W, Zhang D, Wen J. 2015. Enhanced extracellular production of a-amylase in Bacillus subtilis by optimization of regulatory elements and over-expression of PrsA lipoprotein. Biotechnol. Lett. 37: 899-906.
    Pubmed CrossRef