전체메뉴
검색
Article Search

JMB Journal of Microbiolog and Biotechnology

QR Code QR Code

Research article


References

  1. Wei XX, Chen GQ. 2008. Applications of the VHb gene vgb for improved microbial fermentation processes. Methods Enzymol. 436: 273-283.
    Pubmed CrossRef
  2. Stark BC, Dikshit KL, Pagilla KR. 2012. The biochemistry of Vitreoscilla hemoglobin. Comput. Struct. Biotechnol. J. 3: e10002.
    Pubmed PMC CrossRef
  3. Stark BC, Pagilla KR, Dikshit KL. 2015. Recent applications of Vitreoscilla hemoglobin technology in bioproduct synthesis and bioremediation. Appl. Microbiol. Biotechnol. 99: 1627-1636.
    Pubmed CrossRef
  4. Pablos TE, Sigala JC, Le Borgne S, Lara AR. 2014. Aerobic expression of Vitreoscilla hemoglobin efficiently reduces overflow metabolism in Escherichia coli. Biotechnol. J. 9: 791-799.
    Pubmed CrossRef
  5. Juárez M, González-De la Rosa CH, Memún E, Sigala JC, Lara AR. 2017. Aerobic expression of Vitreoscilla hemoglobin improves the growth performance of CHO-K1 cells. Biotechnol. J. 12: 1600438.
    Pubmed CrossRef
  6. Zhang H, Kang X, Xiao N, Gao M, Zhao Y, Zhang B, et al. 2019. Intracellular expression of Vitreoscilla haemoglobin improves lipid production in Yarrowia lipolytica. Lett. Appl. Microbiol. 68: 248-257.
    Pubmed CrossRef
  7. Marisch K, Bayer K, Scharl T, Mairhofer J, Krempl PM, Hummel K, et al. 2013. Comparative analysis of industrial Escherichia coli K-12 and B strains in high-glucose batch cultivations on process-, transcriptome- and proteome level. PLoS One 8: e70516.
    Pubmed PMC CrossRef
  8. Monk JM, Koza A, Campodonico MA, Machado D, Seoane JM, Palsson BO, et al. 2016. Multi-omics quantification of species variation of Escherichia coli links molecular features with strain phenotypes. Cell Syst. 3: 238-251.
    Pubmed PMC CrossRef
  9. Noronha SB, Yeh HJC, Spande TF, Shiloach J. 2000. Investigation of the TCA cycle and the glyoxylate shunt in Escherichia coli BL21 and JM109 using 13C-NMR/MS. Biotechnol. Bioeng. 68: 316-327.
    CrossRef
  10. Phue JN, Noronha SB, Hattacharyya R, Wolfe AJ, Shiloah J. 2005. Glucose metabolism at high density growth of E. coli B and E. coli K: differences in metabolic pathways are responsible for efficient glucose utilization in E. coli B as determined by microarrays and northern blot analyses. Biotechnol. Bioeng. 90: 805-820.
    Pubmed CrossRef
  11. Yang J, Webster DA, Stark BC. 2005. ArcA works with Fnr as a positive regulator of Vitreoscilla (bacterial) hemoglobin gene expression in Escherichia coli. Microbiol. Res. 160: 405-415.
    Pubmed CrossRef
  12. Tsai PS, Hatzimanikatis V, Bailey JE. 1996. Effect of Vitreoscilla hemoglobin dosage on microaerobic Escherichia coli carbon and energy metabolism. Biotechnol. Bioeng. 49: 139-150.
    Pubmed CrossRef
  13. Taymaz-Nikerel H, Borujeni AE, Verheijen PJT, Heijnen JJ, van Gulik WM. 2010. Genome-derived minimal metabolic models for Escherichia coli MG1655 with estimated in vivo respiratory ATP stoichiometry. Biotechnol. Bioeng. 107: 369-381.
    Pubmed CrossRef
  14. Maharjan RP, Seeto S, Ferenci T. 2007. Divergence and redundancy of transport and metabolic rate-yield strategies in a single Escherichia coli population. J. Bacteriol. 189: 2350-2358.
    Pubmed PMC CrossRef
  15. Frey AD, Fiaux J, Szyperski T, Wüthrich K, Bailey JE, Kallio PT. 2001. Dissection of central carbon metabolism of hemoglobin-expressing Escherichia coli by 13C nuclear magnetic resonance flux distribution analysis in microaerobic bioprocesses. Appl. Environ. Microbiol. 67: 680-687.
    Pubmed PMC CrossRef
  16. Kim TS, Jung HY, Kim SY, Zhang L, Li J, Sigdel S, et al. 2015. Reduction of acetate and lactate contributed to enhancement of a recombinant protein production in E. J. Microbiol. Biotechnol. 25: 1093-1100.
    Pubmed CrossRef
  17. Rowley DL, Fawcett WP, Wolf RE Jr. 1992. Molecular characterization of mutations affecting expression level and growth rate-dependent regulation of the Escherichia coli zwf gene. J. Bacteriol. 174: 623-626.
    Pubmed PMC CrossRef
  18. Kim HU, Kim WJ, Lee SY. 2013. Flux-coupled genes and their use in metabolic flux analysis. Biotechnol. J. 8: 1035-1042.
    Pubmed CrossRef
  19. Jaén KE, Velázquez D, Delvigne F, Sigala JC, Lara AR. 2019b. Engineering E. coli for improved microaerobic pDNA production. Bioproc. Biosyst. Eng. 42: 1457-1466.
    Pubmed CrossRef
  20. Jaén KE, Velázquez D, Sigala JC, Lara AR. 2019a. Design of a microaerobically inducible replicon for high-yield plasmid DNA production. Biotechnol. Bioeng. 116: 2514-2525.
    Pubmed CrossRef
  21. Sabido A, Sigala JC, Hernández-Chávez G, Flores N, Gosset G, et al. 2014. Physiological and transcriptional characterization of Escherichia coli strains lacking interconversion of phosphoenolpyruvate and pyruvate when glucose and acetate are coutilized. Biotechnol. Bioeng. 111: 1150-1160.
    Pubmed PMC CrossRef
  22. Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods 25: 402-408.
    Pubmed CrossRef
  23. Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, et al. 2009. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 55: 611-622.
    Pubmed CrossRef

Related articles in JMB

More Related Articles

Article

Research article

J. Microbiol. Biotechnol. 2020; 30(10): 1592-1596

Published online October 28, 2020 https://doi.org/10.4014/jmb.2004.04030

Copyright © The Korean Society for Microbiology and Biotechnology.

Physiological Response of Escherichia coli W3110 and BL21 to the Aerobic Expression of Vitreoscilla Hemoglobin

Alvaro R. Lara*, Janet Galindo, Karim E. Jaén, Mariana Juárez, and Juan-Carlos Sigala

Departamento de Procesos y Tecnología, Universidad Autónoma Metropolitana-Cuajimalpa, Vasco de Quiroga 4871, Santa Fe, CP 05348, Mexico City, Mexico

Correspondence to:*Phone: +52-55-58146500
Fax: +52-55-58146500
E-mail: alara@cua.uam.mx

Received: April 16, 2020; Revised: July 3, 2020; Accepted: July 13, 2020

Abstract

The aerobic growth and metabolic performance of Escherichia coli strains BL21 and W3110 were studied when the Vitreoscilla hemoglobin (VHb) was constitutively expressed in the chromosome. When VHb was expressed, acetate production decreased in both strains and was nearly eliminated in BL21. Transcriptional levels of the glyoxylate shunt genes decreased in both strains when VHb was expressed. However, higher transcription of the α-ketoglutarate dehydrogenase genes were observed for W3110, while for BL21 transcription levels decreased. VHb expression reduced the transcription of the cytochrome bo3 genes only in BL21. These results are useful for better selecting a production host.

Keywords: Vitreoscilla hemoglobin, aerobic cultures, E. coli W3110, BL21, transcriptional analysis

Body

A well-established technology to cope with O2 limitation is the expression of Vitreoscilla hemoglobin (VHb). Possible actions of VHb are the binding to O2 and its delivery to the respiratory chain [1-3]. However, the effect of VHb under aerobic conditions has been only scarcely studied. The VHb-enhanced respiratory activity may increase the fluxes in the tricarboxylic acid cycle (TCA), lowering the aerobic acetate production [4]. As a result, aerobic VHb expression reduced acetate production in several Escherichia coli strains [4], lactate production by CHO cells [5], and the lipids production in Yarrowia lipolytica [6]. The impact of VHb expression in aerobic cultures of the strains E. coli W3110 and BL21, relevant for industrial and academic purposes [7, 8], was studied here. To avoid gene copy variations arising from plasmid-based expression, a single vgb gene copy (coding for VHb) was inserted in the chromosome of BL21 and W3110 and constitutively expressed. The effect of VHb expression was studied in batch cultures (Fig. 1). W3110 produced acetate concomitantly with biomass formation and glucose consumption. At the point of glucose depletion, acetate concentration, oxygen transfer (OTR) and carbon dioxide evolution (CER) rates reached their maximum (Fig. 1C). OTR and CER rapidly decrease thereafter, indicating no O2 limitations. Then, both rates increased transiently, coincident with acetate re-assimilation (Fig. 1A). When VHb was expressed in W3110, the profiles were similar (Figs. 1B and 1D), but around 30% less acetate was accumulated, in comparison with the non-expressing strain. In the case of strain BL21, low amounts of acetate were accumulated (Fig. 1E). Accordingly, no second peaks of OTR and CER were detected after glucose depletion (Fig. 1G). Strain BL21 is well known for its low acetate accumulation and is amply used for high cell-density processes [10]. The low acetate production by BL21 has been attributed to a more active higher expression of glyoxylate shunt genes, compared with K12-derived strains [10, 11]. When VHb was expressed in BL21, acetate accumulation was nearly eliminated (Fig. 1F). Minor amounts of lactate and succinate were found in the samples.

Figure 1. Growth profiles of the engineered E. coli strains. A: Cell growth (circles), glucose (triangles) and acetate concentration (squares) in cultures of strain W3110 recA-; B: Cell growth (circles), glucose (triangles) and acetate concentration (squares) in cultures of strain W3110recA- vgb+; C: Oxygen transfer rate (OTR, squares) and carbon dioxide evolution rate (CER, circles) in cultures of strain W3110 recA-; C: Oxygen transfer rate (OTR, squares) and carbon dioxide evolution rate (CER, circles) in cultures of strain W3110 recA- vgb+; E: Cell growth (circles), glucose (triangles) and acetate concentration (squares) in cultures of strain BL21 recA-; F: Cell growth (circles), glucose (triangles) and acetate concentration (squares) in cultures of strain BL21 recA- vgb+; G: Oxygen transfer rate (OTR, squares) and carbon dioxide evolution rate (CER, circles) in cultures of strain BL21 recA-; H: Oxygen transfer rate (OTR, squares) and carbon dioxide evolution rate (CER, circles) in cultures of strain BL21 recA- vgb+. Cultures were carried out in mineral medium supplemented with 5 g l-1 of glucose under aerobic conditions (DOT ≥ 30% air sat.) and pH 7.0 in 1 l bioreactors. Vertical lines represent the experimental deviation between triplicate cultures.

Despite using the same expression system, the active VHb concentration was more than three-fold higher for BL21 than for W3110 (Fig. 2), which may be attributed to a lower protease activity in BL21, compared to W3110 [7]. The amounts of active VHb found are small compared to previous reports that range from 13-238 nmol gWCW-1 [11] to 3.4-3.8 mmol gDCW-1 (ca. 850-950 nmol gWCW-1) [12] using high-copy number plasmids. Nevertheless, the comparatively small amount of VHb caused relevant physiological changes, as detailed below. While VHb expression did not affect the specific growth rate (μ) in W3110, it was ca. 15 % lower in BL21vgb+, compared to its parent strain (Table 1). The acetate yields decreased by 30 and 60% in W3110 and BL21, respectively, when VHb was expressed. The specific glucose uptake rate (qS) was ca. 12% higher in BL21 than in W3110 wild-types (Table 1). Marisch et al., [7] demonstrated that strain BL21 displays a higher expression of genes involved in glucose transport than K-12 strains. Namely, genes coding for the galactiol PTS permease (gatABC), mannose PTS permease (manXYZ), maltose ABC transporter (malKFGE), and LamB porin (lamB) were overexpressed in BL21, in comparison with a K12 derived strain [7]. This can contribute to the higher qS observed for BL21, compared to W3110. When VHb was expressed in W3110, qS increased by 19 %, compared to the wild-type (Table 1). This may point to an increased glucose oxidation capacity. Growth rate reduction, together with increased qS and qO2 have been also reported for evolved K-12 derivatives [14]. A slight qS decrease (ca. 8%) was observed when VHb was expressed in strain BL21. Such a small decrease qS under aerobic conditions is in agreement with previous results expressing VHb from a high copy-number phagemid under aerobic conditions [4]. Other authors reported a 27% decrease of qS when VHb is expressed from a plasmid in strain MG1655 during microaerobic fed-batch cultures [15]. The qS decrease observed only in BL21 could be linked to the higher VHb expression, compared to W3110, and growth rate reduction. The specific rate of acetate production (qacet) decreased in the strains expressing VHb. Nonetheless, the specific rate of lactate production, which was unaffected by VHb in W3110, increased significantly when VHb was present in BL21. Lactate production under aerobic conditions has been reported for BL21 and attributed to overflow metabolism (excretion of partially oxidized carbon molecules under aerobic conditions) [7, 16]. When aerobic acetate production was diminished through inactivation of the involved pathways, lactate production increased [16], coincident with the results of Table 1. The effect of VHb on specific rate of succinate production was negligible for W3110 but in BL21 decreased by half. The specific oxygen uptake (qO2) and CO2 production (qCO2) rates in W3110 increased by 20%when VHb was expressed, in agreement with its hypothetic function. The estimated qATP, directly proportional to qO2, also indicates a higher energy generation rate in W3110vgb+ and BL21vgb-, compared with W3110vgb- and BL21vgb+, respectively.

Table 1 . Kinetic and stoichiometric parameters of the wild type and engineered strains..

Parameter/StrainW3110W3110vgb+BL21BL21vgb+
µ (h-1)0.53 ± 0.010.53 ± 0.020.54 ± 0.000.46 ± 0.02
Yx/s (g g-1)0.49 ± 0.020.43 ± 0.030.44 ± 0.000.41 ± 0.00
Yacet/S (g g-1)0.13 ± 0.010.09 ± 0.010.05 ± 0.010.02 ± 0.00
-qS (g g-1 h-1)1.10 ± 0.071.31 ± 0.081.23 ± 0.001.13 ± 0.05
qacet (g g-1 h-1)0.16 ± 0.010.10 ± 0.010.05 ± 0.010.02 ± 0.00
qlac (g g-1 h-1)0.008 ± 0.0010.010 ± 0.0010.002 ± 0.0000.049 ± 0.006
qsuc (g g-1 h-1)0.012 ± 0.0010.015 ± 0.0010.002 ± 0.0000.001 ± 0.000
-qO2 (mmol g-1 h-1)15.0 ± 0.518.3 ± 1.119.9 ± 2.115.4 ± 0.4
qCO2 (mmol g-1 h-1)13.1 ± 0.715.9 ± 1.018.3 ± 1.815.0 ± 0.8
qATP (mmol g-1 h-1)a44.7 ± 1.4954.5 ± 3.059.3 ± 6.345.9 ± 1.19
RQ0.87 ± 0.030.87 ± 0.020.92 ± 0.020.94 ± 0.00

Data correspond to the mean of duplicate cultures and were calculated during the exponential growth phase. m: specific growth rate; Yx/s: biomass yield from glucose; Yacet/S: acetate yield from glucose; qS: specific glucose consumption rate; qacet: specific acetate production rate; qlac: specific lactate production rate; qsuc: specific succinate production rate; qO2: specific oxygen uptake rate; qCO2: specific carbon dioxide production rate. qATP was calculated with an stoichiometry of 1.49 mol ATP/1/2 molO2 [13]..


Figure 2. Typical CO differential spectra of E. coli strains BL21 (upper line) and W3110 (lower line) constitutively expressing VHb. Samples were taken from aerobic cultures and spectral analyses were performed from the lysate of 0.5 g of wet cells. Average and standard deviation includes the results from triplicate cultures.

The transcription level of zwf gene, coding for the first enzyme of the pentose phosphate pathway (PPP) was nearly two-fold in W3110vgb+, but was slightly lower in BL21vgb+, compared with their parent strains (Fig. 3). This may indicate a change in the flux to the PPP, since the expression of zwf is consistently linked to the flux in the corresponding pathway [16]. This is consistent with flux balance analysis performed by Tsai and coworkers [12], who estimated a higher flux through the PPP when VHb was expressed in strain W3110 under microaerobic conditions. However, a similar hypothesis about the flux through the PPP in BL21 cannot be formulated with the available information. Nevertheless, it is known that zwf expression is growth-rate regulated [17], which is in agreement with the lower μ in BL21vgb+. The acetate forming pathways were slightly affected by the presence of VHb in W3110. While the poxB expression was unaffected in both strains, pta expression in BL21 was slightly repressed. This is in agreement with the observed reduction of acetate production. Genes from the glyoxylate shunt in BL21 were also slightly repressed when VHb was present. This may be linked to a lower re-assimilation of acetate during cell growth, consequence of a lower acetate production. The genes coding for enzymes of the oxidative decarboxylation of α-ketoglutarate (sucA and sucB) were overexpressed in W3110vgb+, relative to its wild-type. sucA transcription level is also consistently linked to the flux in the involved reaction [18]. The reaction involved produces CO2, which is in agreement with the observed increase of qCO2 in W3110vgb+ (Table 1). In contrast, the expression of sucA and sucB was lower in BL21vgb+, relative to its wild-type, in agreement with the qCO2 decrease on (Table 1). Moreover, the decarboxylation of α-ketoglutarate produces NADH. The lower NADH synthesis expected in strain BL21 as effect of VHb expression, can be linked with a reduced transmembrane proton gradient. As consequence, less ATP is produced (Table 1). cyoA and cyoB code for components of the cytochrome bo3, which is the cytochrome prevailing under aerobic conditions in E. coli. The transcription levels of such genes were not affected by VHb in W3110. In contrast, cyoB was repressed in BL21. This may be related with a lower NADH regeneration NADH by SucA (1 NADH mol per succinyl-CoA mol synthetized), which is a key cofactor driving the respiratory chain and consistent with the lower qO2 observed (Table 1). The results show that the effects of aerobic VHb expression will depend on the particular strain used, and that different advantages (like reduced acetate accumulation) and potential disadvantages (like lower growth rate in BL21) may arise.

Figure 3. Expression levels of strains W3110vgb+ relative to W3110vgb- (left numbers) and BL21 vgb+ relative to BL21vgb- (right numbers). The results are shown above the arrows of the reactions where the transcription product is involved. Standard deviation ranges between 4 and 20%.

Materials and Methods

Strains and Culture Conditions and Off-Line Analyses

The Escherichia coli strains used in this study were W3110recA- and BL21(DE3) recA-. The vgb gene, coding for the Vitreoscilla stercoraria hemoglobin was synthesized by GeneScript (USA). Then, it was cloned in pLoxGentrc between the NcoI and EcoRI sites downstream the trc promoter (Ptrc). The DNA region comprising Ptrc, vgb and gentamicin resistance genes flanked by Lox sequences was then PCR amplified from the using the high-fidelity polymerase Phusion (ThermoScientific, USA) and oligonucleotides 5´-GTTATTTCTTGATGTCTCTGACCA GACACCCATCAACAGTATTATTTTCTAGCTTATCATCGACTGCACG-3´and 5´-GACATGGCCTGCCCG GTTATTATTATTTTTGACACCAGACCAACTGCACAGATGCGTAAGGAGAA-3´ [19, 20]. The resulting 2,487 nt product was used to transform the E. coli strains bearing the plasmid was pKD46, in which the Red system proteins were already induced with arabinose. This way, the PCR product was integrated into the chromosome by homologous recombination between lacI and lacZ. The integration was confirmed by resistance to gentamicin and the absence of blue coloration in colonies grown in LB agar containing X-Gal 10 μg/ml and IPTG (1 mM). PCR tests demonstrated successful integration of vgb. Engineered cells were inoculated in 250 ml shake-flasks containing 50 ml of mineral medium during 12-16 h, in orbital shakers at 250 rpm and 37°C. The composition of the medium is as follows: K2HPO4, 17; KH2PO4, 5.3; (NH4)2SO4, 2.5; NH4Cl, 1.0; Citrate-Na3·2H2O, 2; MgSO4·7H2O, 1.0; Thiamine-HCl, 0.01. The medium was supplemented with trace element solution (2 ml/l) and kanamycin sulfate (50 μg/ml). The trace element solution composition (in g/l) was ZnCl2, 10.5; EDTA, 5.5; CoSO4·7H2O, 1.5; MnSO4·H2O, 6.4; CuSO4·5H2O, 1.1; H3BO3, 1.5; Na2MoO4·2H2O, 1; FeCl3·6H2O, 51.4; and Cit-H·H2O, 39.9. The broth was collected and used to inoculate the main cultures. Cultures were performed in 500 ml of medium in a 1-l Biostat A Plus bioreactor (Sartorius BBI, Germany) at 37°C, pH 7.2. Dissolved oxygen tension (DOT) was measured using a polarographic sensor (USA). DOT was controlled at 30% air sat. by a varying the stirring rate. Off-gas composition was monitored through a BlueInOne Ferm (BlueSens, Germany) gas analyzer. OTR and CTR were calculated with the proper mass balances [20]. Three independent cultures under each condition were performed.

Active VHb was measured by CO-difference spectral analysis as described by Yang et al. [11] from samples taken during the exponential growth phase and lysed with lysozyme. The CO-difference spectra was measured with an UV-Vis Evolution 300 Spectrophotometer (Thermo Scientific) using the extinction coefficient ε(419–436 nm) = 274 mM-1 cm-1 [11]. Biomass concentration was measured as dry cell weight. Glucose was quantified in an YSI 2700 biochemistry analyzer (YSI Inc., USA). Acetate, lactate and succinate were quantified using enzyme kits (R-Biopharm, Germany).

Transcriptional Analysis

RNA extraction, purification and quality control, as well as cDNA synthesis were performed as previously detailed [20]. RNA integrity numbers of the purified samples were between 7.8 and 9.2. cDNA was synthesized using the primers listed in Supplementary Table 1. The gene gmk (coding for guanylate kinase) was selected from 9 candidates as the internal control gene, due to a nearly constant Cq value in all strains (Table S2). RT-qPCR was performed as described before [21], and the transcription levels calculated after Livak and Schmittgen [22]. These experiments were compliant with MIQE guidelines [23].

Supplemental Materials

Fig 1.

Figure 1.Growth profiles of the engineered E. coli strains. A: Cell growth (circles), glucose (triangles) and acetate concentration (squares) in cultures of strain W3110 recA-; B: Cell growth (circles), glucose (triangles) and acetate concentration (squares) in cultures of strain W3110recA- vgb+; C: Oxygen transfer rate (OTR, squares) and carbon dioxide evolution rate (CER, circles) in cultures of strain W3110 recA-; C: Oxygen transfer rate (OTR, squares) and carbon dioxide evolution rate (CER, circles) in cultures of strain W3110 recA- vgb+; E: Cell growth (circles), glucose (triangles) and acetate concentration (squares) in cultures of strain BL21 recA-; F: Cell growth (circles), glucose (triangles) and acetate concentration (squares) in cultures of strain BL21 recA- vgb+; G: Oxygen transfer rate (OTR, squares) and carbon dioxide evolution rate (CER, circles) in cultures of strain BL21 recA-; H: Oxygen transfer rate (OTR, squares) and carbon dioxide evolution rate (CER, circles) in cultures of strain BL21 recA- vgb+. Cultures were carried out in mineral medium supplemented with 5 g l-1 of glucose under aerobic conditions (DOT ≥ 30% air sat.) and pH 7.0 in 1 l bioreactors. Vertical lines represent the experimental deviation between triplicate cultures.
Journal of Microbiology and Biotechnology 2020; 30: 1592-1596https://doi.org/10.4014/jmb.2004.04030

Fig 2.

Figure 2.Typical CO differential spectra of E. coli strains BL21 (upper line) and W3110 (lower line) constitutively expressing VHb. Samples were taken from aerobic cultures and spectral analyses were performed from the lysate of 0.5 g of wet cells. Average and standard deviation includes the results from triplicate cultures.
Journal of Microbiology and Biotechnology 2020; 30: 1592-1596https://doi.org/10.4014/jmb.2004.04030

Fig 3.

Figure 3.Expression levels of strains W3110vgb+ relative to W3110vgb- (left numbers) and BL21 vgb+ relative to BL21vgb- (right numbers). The results are shown above the arrows of the reactions where the transcription product is involved. Standard deviation ranges between 4 and 20%.
Journal of Microbiology and Biotechnology 2020; 30: 1592-1596https://doi.org/10.4014/jmb.2004.04030

Table 1 . Kinetic and stoichiometric parameters of the wild type and engineered strains..

Parameter/StrainW3110W3110vgb+BL21BL21vgb+
µ (h-1)0.53 ± 0.010.53 ± 0.020.54 ± 0.000.46 ± 0.02
Yx/s (g g-1)0.49 ± 0.020.43 ± 0.030.44 ± 0.000.41 ± 0.00
Yacet/S (g g-1)0.13 ± 0.010.09 ± 0.010.05 ± 0.010.02 ± 0.00
-qS (g g-1 h-1)1.10 ± 0.071.31 ± 0.081.23 ± 0.001.13 ± 0.05
qacet (g g-1 h-1)0.16 ± 0.010.10 ± 0.010.05 ± 0.010.02 ± 0.00
qlac (g g-1 h-1)0.008 ± 0.0010.010 ± 0.0010.002 ± 0.0000.049 ± 0.006
qsuc (g g-1 h-1)0.012 ± 0.0010.015 ± 0.0010.002 ± 0.0000.001 ± 0.000
-qO2 (mmol g-1 h-1)15.0 ± 0.518.3 ± 1.119.9 ± 2.115.4 ± 0.4
qCO2 (mmol g-1 h-1)13.1 ± 0.715.9 ± 1.018.3 ± 1.815.0 ± 0.8
qATP (mmol g-1 h-1)a44.7 ± 1.4954.5 ± 3.059.3 ± 6.345.9 ± 1.19
RQ0.87 ± 0.030.87 ± 0.020.92 ± 0.020.94 ± 0.00

Data correspond to the mean of duplicate cultures and were calculated during the exponential growth phase. m: specific growth rate; Yx/s: biomass yield from glucose; Yacet/S: acetate yield from glucose; qS: specific glucose consumption rate; qacet: specific acetate production rate; qlac: specific lactate production rate; qsuc: specific succinate production rate; qO2: specific oxygen uptake rate; qCO2: specific carbon dioxide production rate. qATP was calculated with an stoichiometry of 1.49 mol ATP/1/2 molO2 [13]..


References

  1. Wei XX, Chen GQ. 2008. Applications of the VHb gene vgb for improved microbial fermentation processes. Methods Enzymol. 436: 273-283.
    Pubmed CrossRef
  2. Stark BC, Dikshit KL, Pagilla KR. 2012. The biochemistry of Vitreoscilla hemoglobin. Comput. Struct. Biotechnol. J. 3: e10002.
    Pubmed KoreaMed CrossRef
  3. Stark BC, Pagilla KR, Dikshit KL. 2015. Recent applications of Vitreoscilla hemoglobin technology in bioproduct synthesis and bioremediation. Appl. Microbiol. Biotechnol. 99: 1627-1636.
    Pubmed CrossRef
  4. Pablos TE, Sigala JC, Le Borgne S, Lara AR. 2014. Aerobic expression of Vitreoscilla hemoglobin efficiently reduces overflow metabolism in Escherichia coli. Biotechnol. J. 9: 791-799.
    Pubmed CrossRef
  5. Juárez M, González-De la Rosa CH, Memún E, Sigala JC, Lara AR. 2017. Aerobic expression of Vitreoscilla hemoglobin improves the growth performance of CHO-K1 cells. Biotechnol. J. 12: 1600438.
    Pubmed CrossRef
  6. Zhang H, Kang X, Xiao N, Gao M, Zhao Y, Zhang B, et al. 2019. Intracellular expression of Vitreoscilla haemoglobin improves lipid production in Yarrowia lipolytica. Lett. Appl. Microbiol. 68: 248-257.
    Pubmed CrossRef
  7. Marisch K, Bayer K, Scharl T, Mairhofer J, Krempl PM, Hummel K, et al. 2013. Comparative analysis of industrial Escherichia coli K-12 and B strains in high-glucose batch cultivations on process-, transcriptome- and proteome level. PLoS One 8: e70516.
    Pubmed KoreaMed CrossRef
  8. Monk JM, Koza A, Campodonico MA, Machado D, Seoane JM, Palsson BO, et al. 2016. Multi-omics quantification of species variation of Escherichia coli links molecular features with strain phenotypes. Cell Syst. 3: 238-251.
    Pubmed KoreaMed CrossRef
  9. Noronha SB, Yeh HJC, Spande TF, Shiloach J. 2000. Investigation of the TCA cycle and the glyoxylate shunt in Escherichia coli BL21 and JM109 using 13C-NMR/MS. Biotechnol. Bioeng. 68: 316-327.
    CrossRef
  10. Phue JN, Noronha SB, Hattacharyya R, Wolfe AJ, Shiloah J. 2005. Glucose metabolism at high density growth of E. coli B and E. coli K: differences in metabolic pathways are responsible for efficient glucose utilization in E. coli B as determined by microarrays and northern blot analyses. Biotechnol. Bioeng. 90: 805-820.
    Pubmed CrossRef
  11. Yang J, Webster DA, Stark BC. 2005. ArcA works with Fnr as a positive regulator of Vitreoscilla (bacterial) hemoglobin gene expression in Escherichia coli. Microbiol. Res. 160: 405-415.
    Pubmed CrossRef
  12. Tsai PS, Hatzimanikatis V, Bailey JE. 1996. Effect of Vitreoscilla hemoglobin dosage on microaerobic Escherichia coli carbon and energy metabolism. Biotechnol. Bioeng. 49: 139-150.
    Pubmed CrossRef
  13. Taymaz-Nikerel H, Borujeni AE, Verheijen PJT, Heijnen JJ, van Gulik WM. 2010. Genome-derived minimal metabolic models for Escherichia coli MG1655 with estimated in vivo respiratory ATP stoichiometry. Biotechnol. Bioeng. 107: 369-381.
    Pubmed CrossRef
  14. Maharjan RP, Seeto S, Ferenci T. 2007. Divergence and redundancy of transport and metabolic rate-yield strategies in a single Escherichia coli population. J. Bacteriol. 189: 2350-2358.
    Pubmed KoreaMed CrossRef
  15. Frey AD, Fiaux J, Szyperski T, Wüthrich K, Bailey JE, Kallio PT. 2001. Dissection of central carbon metabolism of hemoglobin-expressing Escherichia coli by 13C nuclear magnetic resonance flux distribution analysis in microaerobic bioprocesses. Appl. Environ. Microbiol. 67: 680-687.
    Pubmed KoreaMed CrossRef
  16. Kim TS, Jung HY, Kim SY, Zhang L, Li J, Sigdel S, et al. 2015. Reduction of acetate and lactate contributed to enhancement of a recombinant protein production in E. J. Microbiol. Biotechnol. 25: 1093-1100.
    Pubmed CrossRef
  17. Rowley DL, Fawcett WP, Wolf RE Jr. 1992. Molecular characterization of mutations affecting expression level and growth rate-dependent regulation of the Escherichia coli zwf gene. J. Bacteriol. 174: 623-626.
    Pubmed KoreaMed CrossRef
  18. Kim HU, Kim WJ, Lee SY. 2013. Flux-coupled genes and their use in metabolic flux analysis. Biotechnol. J. 8: 1035-1042.
    Pubmed CrossRef
  19. Jaén KE, Velázquez D, Delvigne F, Sigala JC, Lara AR. 2019b. Engineering E. coli for improved microaerobic pDNA production. Bioproc. Biosyst. Eng. 42: 1457-1466.
    Pubmed CrossRef
  20. Jaén KE, Velázquez D, Sigala JC, Lara AR. 2019a. Design of a microaerobically inducible replicon for high-yield plasmid DNA production. Biotechnol. Bioeng. 116: 2514-2525.
    Pubmed CrossRef
  21. Sabido A, Sigala JC, Hernández-Chávez G, Flores N, Gosset G, et al. 2014. Physiological and transcriptional characterization of Escherichia coli strains lacking interconversion of phosphoenolpyruvate and pyruvate when glucose and acetate are coutilized. Biotechnol. Bioeng. 111: 1150-1160.
    Pubmed KoreaMed CrossRef
  22. Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods 25: 402-408.
    Pubmed CrossRef
  23. Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, et al. 2009. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 55: 611-622.
    Pubmed CrossRef