전체메뉴
검색
Article Search

JMB Journal of Microbiolog and Biotechnology

QR Code QR Code

Research article

References

  1. de Veer MJ, Kemp JM, Meeusen EN. 2007. The innate host defence against nematode parasites. Parasite Immunol. 29: 1-9.
    Pubmed CrossRef
  2. Zimmerman LM, Vogel LA, Bowden RM. 2010. Understanding the vertebrate immune system: insights from the reptilian perspective. J. Exp. Biol. 213: 661-671.
    Pubmed CrossRef
  3. Mosser DM, Edwards JP. 2008. Exploring the full spectrum of macrophage activation. Nat. Rev. Immunol. 8: 958-969.
    Pubmed PMC CrossRef
  4. Ocaña-Guzman R, Vázquez-Bolaños L, Sada-Ovalle I. 2018. Receptors that inhibit macrophage activation: mechanisms and signals of regulation and tolerance. J. Immunol. Res. 2018: 8695157.
    Pubmed PMC CrossRef
  5. Arango Duque G, Descoteaux A. 2014. Macrophage cytokines: involvement in immunity and infectious diseases. Front. Immunol. 5: 491.
    Pubmed PMC CrossRef
  6. Wang H, Wang M, Chen J, Tang Y, Dou J, Yu J, et al. 2011. A polysaccharide from Strongylocentrotus nudus eggs protects against myelosuppression and immunosuppression in cyclophosphamide-treated mice. Int. Immunopharmacol. 11: 1946-1953.
    Pubmed CrossRef
  7. Sistigu A, Viaud S, Chaput N, Bracci L, Proietti E, Zitvogel L. 2011. Immunomodulatory effects of cyclophosphamide and implementations for vaccine design. Semin. Immunopathol. 33: 369-383.
    Pubmed CrossRef
  8. Motoyoshi Y, Kaminoda K, Saitoh O, Hamasaki K, Nakao K, Ishii N, et al. 2006. Different mechanisms for anti-tumor effects of low- and high-dose cyclophosphamide. Oncol. Rep. 16: 141-146.
    Pubmed CrossRef
  9. Atsamo AD, Nguelefack TB, Datte JY, Kamanyi A. 2011. Acute and subchronic oral toxicity assessment of the aqueous extract from the stem bark of Erythrina senegalensis DC (Fabaceae) in rodents. J. Ethnopharmacol. 134: 697-702.
    Pubmed CrossRef
  10. El-Abasy M, Motobu M, Nakamura K, Koge K, Onodera T, Vainio O, et al. 2004. Preventive and therapeutic effects of sugar cane extract on cyclophosphamide-induced immuno-suppression in chickens. Int. Immunopharmacol. 4: 983-990.
    Pubmed CrossRef
  11. Wang J, Tong X, Li P, Cao H, Su W. 2012. Immuno-enhancement effects of shenqi fuzheng injection on cyclophosphamide-induced immunosuppression in BALB/c mice. J. Ethnopharmacol. 139: 788-795.
    Pubmed CrossRef
  12. Günther F, Wabnitz GH, Stroh P, Prior B, Obst U, Samstag Y, et al. 2009. Host defence against Staphylococcus aureus biofilms infection: Phagocytosis of biofilms by polymorphonuclear neutrophils (PMN). Mol. Immunol. 46: 1805-1813.
    Pubmed CrossRef
  13. Park TY, Hong MG, Sung H, Kim SY, Suk KT. 2017. Effect of Korean red ginseng in chronic liver disease. J. Ginseng Res. 41: 450-455.
    Pubmed PMC CrossRef
  14. Ernst E. 2010. Panax ginseng: An overview of the clinical evidence. J. Ginseng Res. 34: 259-263.
    CrossRef
  15. Lee NH, Son CG. 2011. Systematic review of randomized controlled trials evaluating the efficacy and safety of ginseng. J. Acupunct. Meridian Stud. 4: 85-97.
    Pubmed CrossRef
  16. Kim JE, Monmai C, Rod-In W, Jang AY, You SG, Lee SM, et al. 2019. Immune enhancement effects of Codium fragile anionic macromolecules combined with red ginseng extract in immune-suppressed mice. J. Microbiol. Biotechnol. 29: 1361-1368.
    Pubmed CrossRef
  17. Helms S. 2004. Cancer prevention and therapeutics: Panax ginseng. Altern. Med. Rev. 9: 259-274.
    Pubmed
  18. Kim S, Lee Y, Cho J. 2014. Korean red ginseng extract exhibits neuroprotective effects through inhibition of apoptotic cell death. Biol. Pharm. Bull. 37: 938-946.
    Pubmed CrossRef
  19. Vuksan V, Sievenpipper J, Jovanovski E, Jenkins AL. 2010. Current clinical evidence for Korean red ginseng in management of diabetes and vascular disease: A Toronto's ginseng clinical testing program. J. Ginseng Res. 34: 264-273.
    CrossRef
  20. Kim SK, Park JH. 2011. Trends in ginseng research in 2010. J. Ginseng Res. 35: 389-398.
    Pubmed PMC CrossRef
  21. Jung CH, Seog HM, Choi IW, Choi HD, Cho HY. 2005. Effects of wild ginseng (Panax ginseng C.A. Meyer) leaves on lipid peroxidation levels and antioxidant enzyme activities in streptozotocin diabetic rats. J. Ethnopharmacol. 98: 245-250.
    Pubmed CrossRef
  22. Joo SS, Won TJ, Lee DI. 2005. Reciprocal activity of ginsenosides in the production of proinflammatory repertoire, and their potential roles in neuroprotection in vivo. Planta. Med. 71: 476-481.
    Pubmed CrossRef
  23. Moon SM, Lee SA, Han SH, Park BR, Choi MS, Kim JS, et al. 2018. Aqueous extract of Codium fragile alleviates osteoarthritis through the MAPK/NF-κB pathways in IL-1β-induced rat primary chondrocytes and a rat osteoarthritis model. Biomed. Pharmacother. 97: 264-270.
    Pubmed CrossRef
  24. Kang CH, Choi YH, Park SY, Kim GY. 2012. Anti-inflammatory effects of methanol extract of Codium fragile in lipopolysaccharide-stimulated RAW 264.7 cells. J. Med. Food 15: 44-50.
    Pubmed CrossRef
  25. Lee C, Park GH, Ahn EM, Kim BA, Park CI, Jang JH. 2013. Protective effect of Codium fragile against UVB-induced pro-inflammatory and oxidative damages in HaCaT cells and BALB/c mice. Fitoterapia 86: 54-63.
    Pubmed CrossRef
  26. Tabarsa M, Karnjanapratum S, Cho M, Kim JK, You S. 2013. Molecular characteristics and biological activities of anionic macromolecules from Codium fragile. Int. J. Biol. Macromol. 59: 1-12.
    Pubmed CrossRef
  27. Monmai C, You S, Park WJ. 2019. Immune-enhancing effects of anionic macromolecules extracted from Codium fragile on cyclophosphamide-treated mice. PLoS One 14: e0211570.
    Pubmed PMC CrossRef
  28. Reverter M, Bontemps N, Lecchini D, Banaigs B, Sasal P. 2014. Use of plant extracts in fish aquaculture as an alternative to chemotherapy: Current status and future perspectives. Aquaculture 433: 50-61.
    CrossRef
  29. Sherif AH, Mahfouz ME. 2019. Immune status of Oreochromis niloticus experimentally infected with Aeromonas hydrophila following feeding with 1, 3 β-glucan and levamisole immunostimulants. Aquaculture 509: 40-46.
    CrossRef
  30. Sevag M, Lackman D, Smolens J. 1938. The isolation of the components of streptococcal nucleoproteins in serologically active form. J. Biol. Chem. 124: 425-436.
  31. Zhu XL, Chen AF, Lin ZB. 2007. Ganoderma lucidum polysaccharides enhance the function of immunological effector cells in immunosuppressed mice. J. Ethnopharmacol. 111: 219-226.
    Pubmed CrossRef
  32. Ray A, Dittel BN. 2010. Isolation of mouse peritoneal cavity cells. J. Vis. Exp. 35: e1488.
    Pubmed PMC CrossRef
  33. Green LC, Wagner DA, Glogowski J, Skipper PL, Wishnok JS, Tannenbaum SR. 1982. Analysis of nitrate, nitrite, and [15N]nitrate in biological fluids. Anal. Biochem. 126: 131-138.
    Pubmed CrossRef
  34. Kim JK, Cho ML, Karnjanapratum S, Shin IS, You SG. 2011. In vitro and in vivo immunomodulatory activity of sulfated polysaccharides from Enteromorpha prolifera. Int. J. Biol. Macromol. 49: 1051-1058.
    Pubmed CrossRef
  35. Weeks BA, Keisler AS, Myrvik QN, Warinner JE. 1987. Differential uptake of neutral red by macrophages from three species of estuarine fish. Dev. Comp. Immunol. 11: 117-124.
    Pubmed CrossRef
  36. Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT Method. Methods 25: 402-408.
    Pubmed CrossRef
  37. Manosroi A, Saraphanchotiwitthaya A, Manosroi J. 2003. Immunomodulatory activities of Clausena excavata Burm. f. wood extracts. J. Ethnopharmacol. 89: 155-160.
    Pubmed CrossRef
  38. Yoo SA, Kim OK, Nam DE, Kim YJ, Baek HY, Jun WJ, et al. 2014. munomodulatory effects of fermented Curcuma longa L. extracts on RAW264.7 cells. J. Korean Soc. Food Sci. Nutr. 43: 216-223.
    CrossRef
  39. Hirayama D, Iida T, Nakase H. 2017. The phagocytic function of macrophage-enforcing innate immunity and tissue homeostasis. Int. J. Mol. Sci. 19: 92-105.
    Pubmed PMC CrossRef
  40. Rahat MA, Hemmerlein B. 2013. Macrophage-tumor cell interactions regulate the function of nitric oxide. Front. Physiol. 4: 144.
    Pubmed PMC CrossRef
  41. Sotolongo J, Ruiz J, Fukata M. 2012. The role of innate immunity in the host defense against intestinal bacterial pathogens. Curr. Infect. Dis. Rep. 14: 15-23.
    Pubmed PMC CrossRef
  42. Navegantes KC, de Souza Gomes R, Pereira PAT, Czaikoski PG, Azevedo CHM, Monteiro MC. 2017. Immune modulation of some autoimmune diseases: the critical role of macrophages and neutrophils in the innate and adaptive immunity. J. Transl. Med. 15: 36-56.
    Pubmed PMC CrossRef
  43. Zhu Q, Liao C, Liu Y, Wang P, Guo W, He M, Huang Z. 2012. Ethanolic extract and water-soluble polysaccharide from Chaenomeles speciosa fruit modulate lipopolysaccharide-induced nitric oxide production in RAW264.7 macrophage cells. J. Ethnopharmacol. 144: 441-447.
    Pubmed CrossRef
  44. Hu SS, Bradshaw HB, Chen JS, Tan B, Walker JM. 2008. Prostaglandin E2 glycerol ester, an endogenous COX-2 metabolite of 2-arachidonoylglycerol, induces hyperalgesia and modulates NFκB activity. Br. J. Pharmacol. 153: 1538-1549.
    Pubmed PMC CrossRef
  45. Lee JH, Moon SH, Kim HS, Park E, Ahn DU, Paik HD. 2017. Immune-enhancing activity of phosvitin by stimulating the production of pro-inflammatory mediator. Poult. Sci. 96: 3872-3878.
    Pubmed CrossRef
  46. Xia Y, Zhai Q. 2010. IL-1β enhances the antibacterial activity of astrocytes by activation of NF-κB. Glia 58: 244-252.
    Pubmed CrossRef
  47. Seo SH, Webster RG. 2002. Tumor necrosis factor alpha exerts powerful anti-influenza virus effects in lung epithelial cells. J. Virol. 76: 1071-1076.
    Pubmed PMC CrossRef
  48. van Horssen R, Ten Hagen TL, Eggermont AM. 2006. TNF-α in cancer treatment: molecular insights, antitumor effects, and clinical utility. Oncologist 11: 397-408.
    Pubmed CrossRef

Related articles in JMB

More Related Articles

Article

Research article

J. Microbiol. Biotechnol. 2020; 30(3): 352-358

Published online March 28, 2020 https://doi.org/10.4014/jmb.1909.09062

Copyright © The Korean Society for Microbiology and Biotechnology.

Co-immunomodulatory Activities of Anionic Macromolecules Extracted from Codium fragile with Red Ginseng Extract on Peritoneal Macrophage of Immune-Suppressed Mice

Ji Eun Kim 1, Chaiwat Monmai 2, Weerawan Rod-in 2, A-yeong Jang 1, 2, Sang-Guan You 1, 2, Sang-min Lee 1, 3, Seok-Kyu Jung 4 and Woo Jung Park 1, 2*

1Department of Wellness-Bio Industry, Gangneung-Wonju National University, Gangneung 25457, Republic of Korea, 2Department of Marine Food Science and Technology, Gangneung-Wonju National University, Gangneung 25457, Republic of Korea, 3Department of Marine Biotechnology, Gangneung-Wonju National University, Gangneung 25457, Republic of Korea, 4Department of Horticulture, Daegu Catholic University, Gyeongsan 38430, Republic of Korea

Received: October 10, 2019; Accepted: December 24, 2019

Abstract

In this study we investigated the immune effects of oral administration of anionic macromolecules extracted from Codium fragile (CFAM) and red ginseng extract mixture on the peritoneal macrophage cells in immune-suppressed mice. Cyclophosphamide (CY) induces the immune-suppressed condition. CY-treated mice were orally fed with different concentrations of CFAM supplemented with red ginseng extract and the peritoneal macrophages collected. CY treatment significantly decreased the immune activities of peritoneal macrophages, compared to the normal mice. The administration of CFAM mixed with red ginseng extract significantly boosted the viability of macrophage cells and nitric oxide production of peritoneal macrophages. Further, the oral administration of CFAM mixed with red ginseng extract up-regulated the expression of iNOS, COX-2, and TLR-4 as well as cytokines such as IL-1β, IL-6, TNF-α, and IFN-γ more than the red ginseng-treated group. This study showed that CFAM enhanced the immune activity of red ginseng extract in the peritoneal macrophage cells of immune-suppressed mice. Furthermore, CFAM might be used as a co-stimulant of red ginseng extract through the regulation of macrophage cells for the enhancement of human health and immunity.

Keywords: Anionic macromolecule, Codium fragile, ginseng, co-immunomodulatory, cyclophosphamide

Introduction

Innate immunity is the body’s first defense mechanism against pathogens and one of the significant systemic reactions that prevent infection to maintain physiological homeostasis [1, 2]. In this innate immune response, macrophages are important immune cells that perform several roles such as host defense, inflammation control, and remodeling of tissue [3]. Macrophage cells normally can be activated from rest by various stimuli for the purpose of immune response [4]. Importantly, macrophages are some of the first cells to start immune response, which partly depend on their Toll-like and scavenger receptors, to specifically respond against foreign proteins, lipoproteins, polysaccharides, and other molecules, and finally play their role in the elimination of external agents such as microorganisms and viruses that enter the body to cause infections [5].

Most anticancer drugs using chemotherapy strategy have shown negative effects on normal immune cells even though they can remove tumor cells [6]. Cyclophosphamide (CY) is a widely used chemotherapeutic drug. In addition, the antitumor effect of CY such as the death of immunogenic cancer cells is proportional to the dosage of CY, often causing immunosuppression and cytotoxic effects, and high doses of CY can cause lymphopenia and cytokine storms [7, 8]. CY also inhibits humoral immune and cellular immune responses by impeding the differentiation and proliferation of macrophages, as well as T and B mother cells [9,10]. Therefore, it is necessary to find a method for reducing the side effects of CY [11, 12].

Ginseng (Panax ginseng) has been one of the most popular and widely consumed traditional medicinal products for over 2,000 years [13] while also being used as a material for health foods in Asian countries [14, 15]. Red ginseng extract has been studied with respect to cancer suppression, blood circulation improvement, and infection-defending action [16]. Various studies have been carried out on the benign reaction of red ginseng on important diseases such as cancer [17], neuronal disease [18], cardiovascular diseases [19], and immune system disorders [20]. Additionally, red ginseng was reported to show antioxidant effects [21] and immune-enhancement effects [22]. Codium fragile is an edible green algae widely disseminated in Northern Europe, Oceania, and East Asia [23] and has been studied for its bio-functional activities including carcinogenic, anti-inflammatory and immune-enhancement effects [24, 25]. According to the report by Tabarsa et al. [26], anionic macromolecules extracted from C. fragile (CFAM) and CFAM provided immune-stimulatory activities in murine macrophage cells. Previous research found that the combination of bioactive materials may give synergetic effects when compared to individual material use [27].

Our recent study showed that CFAM stimulated immune organs such as the spleen and macrophages of CY-induced, immune-suppressed mice [26, 27]. In this study, we investigated the immune effects of oral administration of CFAM and red ginseng extract mixture on the peritoneal macrophage cells in immune-suppressed mice.

Materials and Methods

Animals

Inbred male and 6-week-old BALB/c mice weighing between 21 - 23 g were purchased from Central Lab. Animal Inc. (Korea). All the animals were provided with standard laboratory diet and water for one week before starting the experiment. The experiment protocols in this study were approved by the Gangneung-Wonju National University Committee (GWNU-2018-20).

Materials

Red ginseng extract used is a commercial ginseng syrup extracted from Korean 6-year-old red ginseng purchased from Korea Ginseng Corp. (Korea). CY, levamisole (LVS; an immunostimulant), neutral red solution (0.09% mass fraction of solute), and Griess reagent were obtained from Sigma-Aldrich (USA). LVS induces innate-specific immunity in mammals [28] and is a T cell-independent antigen that modulates natural killer cells and increases both major histocompatibility complex (MHC) receptor expression and cytokine levels [29]. EZ-Cytox Cell Viability Assay Kit was acquired from Daeil Labservice (Korea) and Tri reagent was acquired from Molecular Research Center, Inc. (USA). A high capacity cDNA reverse transcription kit was acquired from Applied Biosystems (USA) and SYBR Premix Ex Taq II were purchased from Takara Bio Inc. (Japan).

Anionic Macromolecule Extraction

CFAM was extracted as described in our previous research [26]. CFAM was isolated from C. fragile by solvents of EtOH and acetone with filtration, centrifugation, evaporation, and deproteinization after milling the samples [30]. The extracted CFAM consisted mainly of carbohydrates (54.6%), proteins (15.7%), sulfates (13.0%) and a small amount of uronic acid (1.4%). Monosaccharide composition analysis revealed that galactose (59.5%) was the major sugar of CFAM.

Development of Immune-Suppressed Mice and Treatment Protocols

After acclimatization for one week, mice were randomly separated into eight groups (n = 5). Two groups were orally administrated with saline (normal group and CY group). The other groups were orally administered with different concentrations of CFAM (0, 25, 50, 75, and 100 mg/kg BW) supplemented with red ginseng extract. LVS was used as a positive control [31] and was orally administered with a concentration of 40 mg/kg BW. All groups were treated one time per day for 10 consecutive days. At day 4-6 after starting administration, all mice, except those in the normal group were given intraperitoneally with CY (80 mg/kg BW), and then sacrificed 24 h after treatment completion.

Peritoneal Macrophage Preparation

Peritoneal macrophages were prepared using the Ray and Dittel method [32] as previously described [27]. After injection into the peritoneal cavity of each mouse with ice-cold phosphate buffered saline (PBS) supplemented with 3% fetal calf serum (FCS), the injected PBS was recollected and the cell pellet obtained after centrifugation for further experiments.

Peritoneal Macrophage Viability and Nitric Oxide (NO) Production Assay

Isolated peritoneal macrophages were supplemented with or without 1 μg/ml of lipopolysaccharides (LPS). After 24 h incubation, NO production in the cultured medium was examined using Griess reagent [33]. The treated cells were also used to investigate macrophage viability using the EZ-Cytox Cell Viability Assay Kit [34]. The treated cells were incubated with the dilution of EZ-Cytox Cell Viability solution at 37°C for 1 h, after which the solution was measured using a microplate reader (EL800, BioTek, USA) at the absorbance of 450 nm. Macrophage viability ratio (%) was evaluated using the following equation:

Macrophage viability ratio (%)=Absorbance of test groupAbsorbance of control group× 100

Peritoneal Macrophage Phagocytosis Assay

For the evaluation of the phagocytosis of peritoneal macrophages, the neutral red uptake method was tested, as mentioned in previous studies [11, 35]. Phagocytosis of macrophage cells was measured using a microplate reader [absorbance (A), 540 nm]. Phagocytosis ratio was assayed using the following equation:

Phagocytosis ratio (%)=AtestAcontrol× 100

RNA Isolation and Reverse Transcription

RNA was gained from the LPS-stimulated peritoneal macrophages by Tri reagent. After confirming the quantity (500 ng) and quality (A260/A280 ratio = 1.80 – 2.10; The A260/A280 ratio gives an indication of purity and pure RNA preparation has expected ratios of ≥2.0) of the RNA extracted by a nanophotometer (Implen, Germany), a high capacity cDNA reverse transcription kit was used for the synthesis of cDNA using RNA as a template.

Immune-Associated Gene Expression Assay

Immune-associated gene expression in peritoneal macrophages was analyzed using SYBR Premix Ex Taq II and a QuantStudio 3 FlexReal-Time PCR System (ThermoFisher Scientific, USA) with 40 cycles of reaction. The specific primer sets for immune-associated genes are presented in Table 1. Relative gene expression was calculated using the 2-ΔΔCT method [36] and β-actin as the reference gene.

Table 1 . Oligonucleotide primers used for evaluating immune gene..

GeneAccession No.Sequences
IL-1βNM_008361.4Forward: GGGCCTCAAAGGAAAGAATC
Reverse: TACCAGTTGGGGAACTCTGC
IL-6NM_031168.2Forward: AGTTGCCTTCTTGGGACTGA
Reverse: CAGAATTGCCATTGCACAAC
IFN-γNM_008337.3Forward: CTCAAGTGGCATAGATGT
Reverse: GAGATAATCTGGCTCTGCAGGATT
TNF-αD84199.2Forward: ATGAGCACAGAAAGCATGATC
Reverse: TACAGGCTTGTCACTCGAATT
TLR-4NM_021297.3Forward: CGCTCTGGCATCATCTTCAT
Reverse: GTTGCCGTTTCTTGTTCTTCC
COX-2NM_011198.4Forward: AGAAGGAAATGGCTGCAGAA
Reverse: GCTCGGCTTCCAGTATTGAG
iNOSBC062378.1Forward: TTCCAGAATCCCTGGACAAG
Reverse: TGGTCAAACTCTTGGGGTTC
β-actinNM_007393.5Forward: CCACAGCTGAGAGGGAAATC
Reverse: AAGGAAGGCTGGAAAAGAGC


Statistical Analysis

All results were statistically analyzed with Statistix 8.1 Statistics Software (USA) using one-way analysis of variance compared with the control. Thereafter, the Tukey post-hoc test was used to measure the significance at p <0.05.

Results

Effect of CFAM and Ginseng Mixture on Peritoneal Macrophage Viability and NO Production

Peritoneal macrophages were collected from each group of mice to examine the effects of CFAM mixed with red ginseng on macrophage viability and NO production in macrophage cells. The treatment of red ginseng extract without CFAM significantly enhanced peritoneal macrophage viability (Fig. 1A) and NO production (Fig. 1B). In addition, red ginseng extract supplemented with CFAM significantly increased macrophage viability and NO production compared to the treatment of red ginseng extract alone. Furthermore, the mixture of CFAM and red ginseng extract restored peritoneal macrophage viability and NO production to the same or higher level than the normal mice in CY-induced immunosuppression condition.

Figure 1. Effects of CFAM and ginseng mixture on peritoneal macrophage. (A) Peritoneal macrophage viability, and (B) peritoneal macrophage NO production. There was significant difference between CY group (*, p < 0.05) and ginseng group (#, p < 0.05).

Effect of CFAM and Ginseng Mixture on Peritoneal Macrophage Phagocytosis

As shown in Fig. 2, CY treatment significantly decreased peritoneal macrophage phagocytosis compared to the normal mice. The mixture of CFAM and red ginseng extract significantly increased peritoneal macrophage phagocytosis in the immune-suppressed mice and exhibited recovery of phagocytosis at a ratio similar to or more than normal mice.

Figure 2. Effects of CFAM and ginseng mixture on peritoneal macrophage phagocytosis ratio. There was significant difference between the CY group (*, p<0.05) and ginseng group (#, p < 0.05).

Effect of CFAM and Ginseng Mixture on Peritoneal Macrophage Immune Gene Expression

CY treatment significantly suppressed the expression of immune-associated genes including IL-1β, IL-6, TNF-α, IFN-γ, COX-2, iNOS, and TLR-4 genes in peritoneal macrophages (Fig. 3). Compared to the CY-treated group, the mixture of CFAM and red ginseng extract highly increased the expression of these immune-associated genes. In addition, peritoneal macrophages treated with 25 and 50 mg/kg BW of CFAM plus 100 mg/kg BW of red ginseng extract showed higher expression of these immune-associated genes than the red ginseng alone-treated group. Especially, the mixture of CFAM and red ginseng extract showed even higher response of immune-associated genes in peritoneal macro-phages than in normal mice.

Figure 3. Effects of CFAM and ginseng mixture on peritoneal macrophage immune-associated gene expression. (A) iNOS, (B) IL-1β, (C) IL-6, (D) COX-2, (E) TNF-α, (F) IFN-γ, and (G) TLR-4 expression. There was significant difference between the CY group (*, p < 0.05) and ginseng group (#, p < 0.05).

Discussion

Macrophages are immune cells that play critical roles in resisting infection and eliminating tumor cells in the host [37]. They secrete NO that contributes to the immune response [38] and whose main function is to mediate the ability of the activated macrophage to kill bacteria and tumor cells [39] i.e., macrophages protect the host cells from infection by increasing the production of NO [40]. Phagocytosis is one of the first defense mechanisms against infection by pathogens [12, 41] and is also crucial for both adaptive and innate immunity [42]. Macrophages are one of the most important types of cells among the phagocytes in our immune system [24]. Fig. 1 shows that CFAM and red ginseng extract enhanced the viability and NO production of peritoneal macrophages, whereas CY suppressed peritoneal macrophage viability and NO production. In addition, CFAM and red ginseng extract increased the phagocytosis activity of peritoneal macrophages, suggesting that CFAM and red ginseng extract enhanced non-specific immune functions in the immune-suppressed mice.

Macrophages play critical roles in innate and adaptive immune responses to pathogens through phagocytosis, antigen presentation, and cytokines secretion [43]. In these cells, the iNOS gene regulates the production of NO which is a well-known pro-inflammatory mediator [44] and secrete pro-inflammatory cytokines such as TNF-α and IL-1β [45]. The secreted cytokines are important for antigen defense as they regulate the immune system for anti-bacterial [46], anti-viral [47] and anti-tumor functions [48]. As shown in Fig. 3, CY suppressed the cytokine expression levels of peritoneal macrophages compared to the normal mice. However, the treatment of CFAM and red ginseng extract enhanced peritoneal macrophage cytokine expression responses to B cell mitogen (LPS). This indicates that CFAM and red ginseng extract could promote the secretion of peritoneal macrophage cytokines in order to restore immunosuppression.

The present study demonstrated that CFAM mixed with red ginseng extract enhanced the immune responses in CY-induced immune-suppressed mice through peritoneal macrophage viability, NO production, phagocytosis of peritoneal macrophage, and immune-associated gene expre-ssion in peritoneal macrophage. These immune response activities of CFAM mixed with red ginseng extract showed higher activities than those observed in the red ginseng only treated-group. CFAM enhanced the immune activity of red ginseng extract in the peritoneal macrophage cells of immune-suppressed mice. Furthermore, CFAM might be used as a co-stimulant of red ginseng extract through the regulation of macrophage cells for the enhancement of human health and immunity.

Acknowledgments

This study was supported by the Marine Bio-Regional Specialization Leading Technology Development Program (D11413914H480000100) funded by the Ministry of Oceans and Fisheries in Korea and the Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Science, ICT & Future Planning (2019R1A2B5B01070542). This research project was also supported by the University Emphasis Research Institute Support Program (No.2018R1A61A03023584) from the National Research Foundation of Korea.

Conflict of Interest

The authors have no financial conflicts of interest to declare.

Fig 1.

Figure 1.Effects of CFAM and ginseng mixture on peritoneal macrophage. (A) Peritoneal macrophage viability, and (B) peritoneal macrophage NO production. There was significant difference between CY group (*, p < 0.05) and ginseng group (#, p < 0.05).
Journal of Microbiology and Biotechnology 2020; 30: 352-358https://doi.org/10.4014/jmb.1909.09062

Fig 2.

Figure 2.Effects of CFAM and ginseng mixture on peritoneal macrophage phagocytosis ratio. There was significant difference between the CY group (*, p<0.05) and ginseng group (#, p < 0.05).
Journal of Microbiology and Biotechnology 2020; 30: 352-358https://doi.org/10.4014/jmb.1909.09062

Fig 3.

Figure 3.Effects of CFAM and ginseng mixture on peritoneal macrophage immune-associated gene expression. (A) iNOS, (B) IL-1β, (C) IL-6, (D) COX-2, (E) TNF-α, (F) IFN-γ, and (G) TLR-4 expression. There was significant difference between the CY group (*, p < 0.05) and ginseng group (#, p < 0.05).
Journal of Microbiology and Biotechnology 2020; 30: 352-358https://doi.org/10.4014/jmb.1909.09062

Table 1 . Oligonucleotide primers used for evaluating immune gene..

GeneAccession No.Sequences
IL-1βNM_008361.4Forward: GGGCCTCAAAGGAAAGAATC
Reverse: TACCAGTTGGGGAACTCTGC
IL-6NM_031168.2Forward: AGTTGCCTTCTTGGGACTGA
Reverse: CAGAATTGCCATTGCACAAC
IFN-γNM_008337.3Forward: CTCAAGTGGCATAGATGT
Reverse: GAGATAATCTGGCTCTGCAGGATT
TNF-αD84199.2Forward: ATGAGCACAGAAAGCATGATC
Reverse: TACAGGCTTGTCACTCGAATT
TLR-4NM_021297.3Forward: CGCTCTGGCATCATCTTCAT
Reverse: GTTGCCGTTTCTTGTTCTTCC
COX-2NM_011198.4Forward: AGAAGGAAATGGCTGCAGAA
Reverse: GCTCGGCTTCCAGTATTGAG
iNOSBC062378.1Forward: TTCCAGAATCCCTGGACAAG
Reverse: TGGTCAAACTCTTGGGGTTC
β-actinNM_007393.5Forward: CCACAGCTGAGAGGGAAATC
Reverse: AAGGAAGGCTGGAAAAGAGC

References

  1. de Veer MJ, Kemp JM, Meeusen EN. 2007. The innate host defence against nematode parasites. Parasite Immunol. 29: 1-9.
    Pubmed CrossRef
  2. Zimmerman LM, Vogel LA, Bowden RM. 2010. Understanding the vertebrate immune system: insights from the reptilian perspective. J. Exp. Biol. 213: 661-671.
    Pubmed CrossRef
  3. Mosser DM, Edwards JP. 2008. Exploring the full spectrum of macrophage activation. Nat. Rev. Immunol. 8: 958-969.
    Pubmed KoreaMed CrossRef
  4. Ocaña-Guzman R, Vázquez-Bolaños L, Sada-Ovalle I. 2018. Receptors that inhibit macrophage activation: mechanisms and signals of regulation and tolerance. J. Immunol. Res. 2018: 8695157.
    Pubmed KoreaMed CrossRef
  5. Arango Duque G, Descoteaux A. 2014. Macrophage cytokines: involvement in immunity and infectious diseases. Front. Immunol. 5: 491.
    Pubmed KoreaMed CrossRef
  6. Wang H, Wang M, Chen J, Tang Y, Dou J, Yu J, et al. 2011. A polysaccharide from Strongylocentrotus nudus eggs protects against myelosuppression and immunosuppression in cyclophosphamide-treated mice. Int. Immunopharmacol. 11: 1946-1953.
    Pubmed CrossRef
  7. Sistigu A, Viaud S, Chaput N, Bracci L, Proietti E, Zitvogel L. 2011. Immunomodulatory effects of cyclophosphamide and implementations for vaccine design. Semin. Immunopathol. 33: 369-383.
    Pubmed CrossRef
  8. Motoyoshi Y, Kaminoda K, Saitoh O, Hamasaki K, Nakao K, Ishii N, et al. 2006. Different mechanisms for anti-tumor effects of low- and high-dose cyclophosphamide. Oncol. Rep. 16: 141-146.
    Pubmed CrossRef
  9. Atsamo AD, Nguelefack TB, Datte JY, Kamanyi A. 2011. Acute and subchronic oral toxicity assessment of the aqueous extract from the stem bark of Erythrina senegalensis DC (Fabaceae) in rodents. J. Ethnopharmacol. 134: 697-702.
    Pubmed CrossRef
  10. El-Abasy M, Motobu M, Nakamura K, Koge K, Onodera T, Vainio O, et al. 2004. Preventive and therapeutic effects of sugar cane extract on cyclophosphamide-induced immuno-suppression in chickens. Int. Immunopharmacol. 4: 983-990.
    Pubmed CrossRef
  11. Wang J, Tong X, Li P, Cao H, Su W. 2012. Immuno-enhancement effects of shenqi fuzheng injection on cyclophosphamide-induced immunosuppression in BALB/c mice. J. Ethnopharmacol. 139: 788-795.
    Pubmed CrossRef
  12. Günther F, Wabnitz GH, Stroh P, Prior B, Obst U, Samstag Y, et al. 2009. Host defence against Staphylococcus aureus biofilms infection: Phagocytosis of biofilms by polymorphonuclear neutrophils (PMN). Mol. Immunol. 46: 1805-1813.
    Pubmed CrossRef
  13. Park TY, Hong MG, Sung H, Kim SY, Suk KT. 2017. Effect of Korean red ginseng in chronic liver disease. J. Ginseng Res. 41: 450-455.
    Pubmed KoreaMed CrossRef
  14. Ernst E. 2010. Panax ginseng: An overview of the clinical evidence. J. Ginseng Res. 34: 259-263.
    CrossRef
  15. Lee NH, Son CG. 2011. Systematic review of randomized controlled trials evaluating the efficacy and safety of ginseng. J. Acupunct. Meridian Stud. 4: 85-97.
    Pubmed CrossRef
  16. Kim JE, Monmai C, Rod-In W, Jang AY, You SG, Lee SM, et al. 2019. Immune enhancement effects of Codium fragile anionic macromolecules combined with red ginseng extract in immune-suppressed mice. J. Microbiol. Biotechnol. 29: 1361-1368.
    Pubmed CrossRef
  17. Helms S. 2004. Cancer prevention and therapeutics: Panax ginseng. Altern. Med. Rev. 9: 259-274.
    Pubmed
  18. Kim S, Lee Y, Cho J. 2014. Korean red ginseng extract exhibits neuroprotective effects through inhibition of apoptotic cell death. Biol. Pharm. Bull. 37: 938-946.
    Pubmed CrossRef
  19. Vuksan V, Sievenpipper J, Jovanovski E, Jenkins AL. 2010. Current clinical evidence for Korean red ginseng in management of diabetes and vascular disease: A Toronto's ginseng clinical testing program. J. Ginseng Res. 34: 264-273.
    CrossRef
  20. Kim SK, Park JH. 2011. Trends in ginseng research in 2010. J. Ginseng Res. 35: 389-398.
    Pubmed KoreaMed CrossRef
  21. Jung CH, Seog HM, Choi IW, Choi HD, Cho HY. 2005. Effects of wild ginseng (Panax ginseng C.A. Meyer) leaves on lipid peroxidation levels and antioxidant enzyme activities in streptozotocin diabetic rats. J. Ethnopharmacol. 98: 245-250.
    Pubmed CrossRef
  22. Joo SS, Won TJ, Lee DI. 2005. Reciprocal activity of ginsenosides in the production of proinflammatory repertoire, and their potential roles in neuroprotection in vivo. Planta. Med. 71: 476-481.
    Pubmed CrossRef
  23. Moon SM, Lee SA, Han SH, Park BR, Choi MS, Kim JS, et al. 2018. Aqueous extract of Codium fragile alleviates osteoarthritis through the MAPK/NF-κB pathways in IL-1β-induced rat primary chondrocytes and a rat osteoarthritis model. Biomed. Pharmacother. 97: 264-270.
    Pubmed CrossRef
  24. Kang CH, Choi YH, Park SY, Kim GY. 2012. Anti-inflammatory effects of methanol extract of Codium fragile in lipopolysaccharide-stimulated RAW 264.7 cells. J. Med. Food 15: 44-50.
    Pubmed CrossRef
  25. Lee C, Park GH, Ahn EM, Kim BA, Park CI, Jang JH. 2013. Protective effect of Codium fragile against UVB-induced pro-inflammatory and oxidative damages in HaCaT cells and BALB/c mice. Fitoterapia 86: 54-63.
    Pubmed CrossRef
  26. Tabarsa M, Karnjanapratum S, Cho M, Kim JK, You S. 2013. Molecular characteristics and biological activities of anionic macromolecules from Codium fragile. Int. J. Biol. Macromol. 59: 1-12.
    Pubmed CrossRef
  27. Monmai C, You S, Park WJ. 2019. Immune-enhancing effects of anionic macromolecules extracted from Codium fragile on cyclophosphamide-treated mice. PLoS One 14: e0211570.
    Pubmed KoreaMed CrossRef
  28. Reverter M, Bontemps N, Lecchini D, Banaigs B, Sasal P. 2014. Use of plant extracts in fish aquaculture as an alternative to chemotherapy: Current status and future perspectives. Aquaculture 433: 50-61.
    CrossRef
  29. Sherif AH, Mahfouz ME. 2019. Immune status of Oreochromis niloticus experimentally infected with Aeromonas hydrophila following feeding with 1, 3 β-glucan and levamisole immunostimulants. Aquaculture 509: 40-46.
    CrossRef
  30. Sevag M, Lackman D, Smolens J. 1938. The isolation of the components of streptococcal nucleoproteins in serologically active form. J. Biol. Chem. 124: 425-436.
  31. Zhu XL, Chen AF, Lin ZB. 2007. Ganoderma lucidum polysaccharides enhance the function of immunological effector cells in immunosuppressed mice. J. Ethnopharmacol. 111: 219-226.
    Pubmed CrossRef
  32. Ray A, Dittel BN. 2010. Isolation of mouse peritoneal cavity cells. J. Vis. Exp. 35: e1488.
    Pubmed KoreaMed CrossRef
  33. Green LC, Wagner DA, Glogowski J, Skipper PL, Wishnok JS, Tannenbaum SR. 1982. Analysis of nitrate, nitrite, and [15N]nitrate in biological fluids. Anal. Biochem. 126: 131-138.
    Pubmed CrossRef
  34. Kim JK, Cho ML, Karnjanapratum S, Shin IS, You SG. 2011. In vitro and in vivo immunomodulatory activity of sulfated polysaccharides from Enteromorpha prolifera. Int. J. Biol. Macromol. 49: 1051-1058.
    Pubmed CrossRef
  35. Weeks BA, Keisler AS, Myrvik QN, Warinner JE. 1987. Differential uptake of neutral red by macrophages from three species of estuarine fish. Dev. Comp. Immunol. 11: 117-124.
    Pubmed CrossRef
  36. Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT Method. Methods 25: 402-408.
    Pubmed CrossRef
  37. Manosroi A, Saraphanchotiwitthaya A, Manosroi J. 2003. Immunomodulatory activities of Clausena excavata Burm. f. wood extracts. J. Ethnopharmacol. 89: 155-160.
    Pubmed CrossRef
  38. Yoo SA, Kim OK, Nam DE, Kim YJ, Baek HY, Jun WJ, et al. 2014. munomodulatory effects of fermented Curcuma longa L. extracts on RAW264.7 cells. J. Korean Soc. Food Sci. Nutr. 43: 216-223.
    CrossRef
  39. Hirayama D, Iida T, Nakase H. 2017. The phagocytic function of macrophage-enforcing innate immunity and tissue homeostasis. Int. J. Mol. Sci. 19: 92-105.
    Pubmed KoreaMed CrossRef
  40. Rahat MA, Hemmerlein B. 2013. Macrophage-tumor cell interactions regulate the function of nitric oxide. Front. Physiol. 4: 144.
    Pubmed KoreaMed CrossRef
  41. Sotolongo J, Ruiz J, Fukata M. 2012. The role of innate immunity in the host defense against intestinal bacterial pathogens. Curr. Infect. Dis. Rep. 14: 15-23.
    Pubmed KoreaMed CrossRef
  42. Navegantes KC, de Souza Gomes R, Pereira PAT, Czaikoski PG, Azevedo CHM, Monteiro MC. 2017. Immune modulation of some autoimmune diseases: the critical role of macrophages and neutrophils in the innate and adaptive immunity. J. Transl. Med. 15: 36-56.
    Pubmed KoreaMed CrossRef
  43. Zhu Q, Liao C, Liu Y, Wang P, Guo W, He M, Huang Z. 2012. Ethanolic extract and water-soluble polysaccharide from Chaenomeles speciosa fruit modulate lipopolysaccharide-induced nitric oxide production in RAW264.7 macrophage cells. J. Ethnopharmacol. 144: 441-447.
    Pubmed CrossRef
  44. Hu SS, Bradshaw HB, Chen JS, Tan B, Walker JM. 2008. Prostaglandin E2 glycerol ester, an endogenous COX-2 metabolite of 2-arachidonoylglycerol, induces hyperalgesia and modulates NFκB activity. Br. J. Pharmacol. 153: 1538-1549.
    Pubmed KoreaMed CrossRef
  45. Lee JH, Moon SH, Kim HS, Park E, Ahn DU, Paik HD. 2017. Immune-enhancing activity of phosvitin by stimulating the production of pro-inflammatory mediator. Poult. Sci. 96: 3872-3878.
    Pubmed CrossRef
  46. Xia Y, Zhai Q. 2010. IL-1β enhances the antibacterial activity of astrocytes by activation of NF-κB. Glia 58: 244-252.
    Pubmed CrossRef
  47. Seo SH, Webster RG. 2002. Tumor necrosis factor alpha exerts powerful anti-influenza virus effects in lung epithelial cells. J. Virol. 76: 1071-1076.
    Pubmed KoreaMed CrossRef
  48. van Horssen R, Ten Hagen TL, Eggermont AM. 2006. TNF-α in cancer treatment: molecular insights, antitumor effects, and clinical utility. Oncologist 11: 397-408.
    Pubmed CrossRef