전체메뉴
검색
Article Search

JMB Journal of Microbiolog and Biotechnology

QR Code QR Code

Research article

References

  1. Wagner EGH, Romby P. 2015. Small RNAs in bacteria and archaea: who they are, what they do, and how they do it. Adv. Genet. 90: 133-208.
    Pubmed CrossRef
  2. Melamed S, Peer A, Faigenbaum-Romm R, Gatt YE, Reiss N, Bar A, et al. 2016. Global mapping of small RNA-target interactions in bacteria. Mol. Cell. 63: 884-897.
    Pubmed PMC CrossRef
  3. Frohlich KS, Gottesman S. 2018. Small regulatory RNAs in the enterobacterial response to envelope damage and oxidative stress. Microbiol. Spectr. 6: RWR-22.
    Pubmed PMC CrossRef
  4. Kavita K, de Mets F, Gottesman S. 2018. New aspects of RNA-based regulation by Hfq and its partner sRNAs. Curr. Opin. Microbiol. 42: 53-61.
    Pubmed CrossRef
  5. Gimpel M, Brantl S. 2016. Dual-function sRNA encoded peptide SR1P modulates moonlighting activity of B. subtilis GapA. RNA Biol. 13: 916-926.
    Pubmed PMC CrossRef
  6. Evguenieva-Hackenberg E, Klug G. 2011. New aspects of RNA processing in prokaryotes. Curr. Opin. Microbiol. 14: 587-592.
    Pubmed CrossRef
  7. Klein G, Raina S. 2017. Small regulatory bacterial RNAs regulating the envelope stress response. Biochem. Soc. Trans. 45: 417-425.
    Pubmed PMC CrossRef
  8. Klein G, Stupak A, Biernacka D, Wojtkiewicz P, Lindner B, Raina S. 2016. Multiple transcriptional factors regulate transcription of the rpoE gene in Escherichia coli under different growth conditions and when the lipopolysaccharide biosynthesis is defective. J. Biol. Chem. 291: 22999-23019.
    Pubmed PMC CrossRef
  9. Zhang Y, Yan D, Xia L, Zhao X, Osei-Adjei G, Xu S, et al. 2017. The malS-5'UTR regulates hisG, a key gene in the histidine biosynthetic pathway in Salmonella enterica serovar Typhi. Can. J. Microbiol. 63: 287-295.
    Pubmed CrossRef
  10. Chao Y, Vogel J. 2016. A 3' UTR-derived small RNA provides the regulatory noncoding arm of the inner membrane stress response. Mol. Cell 61: 352-363.
    Pubmed CrossRef
  11. Klein G, Kobylak N, Lindner B, Stupak A, Raina S. 2014. Assembly of lipopolysaccharide in Escherichia coli requires the essential LapB heat shock protein. J. Biol. Chem. 289: 14829-14853.
    Pubmed PMC CrossRef
  12. Zhao X, Liu R, Tang H, Osei-Adjei G, Xu S, Zhang Y, et al. 2018. A 3' UTR-derived non-coding RNA RibS increases expression of cfa and promotes biofilm formation of Salmonella enterica serovar Typhi. Res. Microbiol. 169: 279-288.
    Pubmed CrossRef
  13. Kroger C, Rothhardt JE, Brokatzky D, Felsl A, Kary SC, Heermann R, et al. 2018. The small RNA RssR regulates myo-inositol degradation by Salmonella enterica. Sci. Rep. 8: 17739.
    Pubmed PMC CrossRef
  14. Georg J, Hess WR. 2011. cis-antisense RNA, another level of gene regulation in bacteria. Microbiol. Mol. Biol. Rev. 75: 286-300.
    Pubmed PMC CrossRef
  15. Georg J, Hess WR. 2018. Widespread antisense transcription in prokaryotes. Microbiol. Spectr. 6: RWR-29.
    Pubmed CrossRef
  16. Manna AC, Kim S, Cengher L, Corvaglia A, Leo S, Francois P, et al. 2018. Small RNA teg49 is derived from a sarA transcript and regulates virulence genes independent of SarA in Staphylococcus aureus. Infect. Immun. 86. pii: e00635-17.
    Pubmed PMC CrossRef
  17. Argaman L, Hershberg R, Vogel J, Bejerano G, Wagner EG, Margalit H, et al. 2001. Novel small RNA-encoding genes in the intergenic regions of Escherichia coli. Curr. Biol. 11: 941-950.
    Pubmed CrossRef
  18. Saito S, Kakeshita H, Nakamura K. 2009. Novel small RNA-encoding genes in the intergenic regions of Bacillus subtilis. Gene 428: 2-8.
    Pubmed CrossRef
  19. Baekkedal C, Haugen P. 2015. The Spot 42 RNA: a regulatory small RNA with roles in the central metabolism. RNA Biol. 12: 1071-1077.
    Pubmed PMC CrossRef
  20. Guo MS, Updegrove TB, Gogol EB, Shabalina SA, Gross CA, Storz G. 2014. MicL, a new σE-dependent sRNA, combats envelope stress by repressing synthesis of Lpp, the major outer membrane lipoprotein. Genes Dev. 28: 1620-1634.
    Pubmed PMC CrossRef
  21. Beisel CL, Storz G. 2010. Base pairing small RNAs and their roles in global regulatory networks. FEMS Microbiol. Rev. 34: 866-882.
    Pubmed PMC CrossRef
  22. Mandin P, Chareyre S, Barras F. 2016. A regulatory circuit composed of a transcription factor, IscR, and a regulatory RNA, RyhB, controls Fe-S cluster delivery. MBio. 7: e00966-16.
    Pubmed PMC CrossRef
  23. Prevost K, Salvail H, Desnoyers G, Jacques JF, Phaneuf E, Masse E. 2007. The small RNA RyhB activates the translation of shiA mRNA encoding a permease of shikimate, a compound involved in siderophore synthesis. Mol. Microbiol. 64: 1260-1273.
    Pubmed CrossRef
  24. Vecerek B, Moll I, Blasi U. 2007. Control of Fur synthesis by the non-coding RNA RyhB and iron-responsive decoding. EMBO J. 26: 965-975.
    Pubmed PMC CrossRef
  25. Kim HM, Shin JH, Cho YB, Roe JH. 2014. Inverse regulation of Fe- and Ni-containing SOD genes by a Fur family regulator Nur through small RNA processed from 3'UTR of the sodF mRNA. Nucleic Acids Res. 42: 2003.
    Pubmed PMC CrossRef
  26. Tanwer P, Bauer S, Heinrichs E, Panda G, Saluja D, Rudel T, Beier D. 2017. Post-transcriptional regulation of target genes by the sRNA FnrS in Neisseria gonorrhoeae. Microbiology 163: 1081-1092.
    Pubmed CrossRef
  27. Durand S, Storz G. 2010. Reprogramming of anaerobic metabolism by the FnrS small RNA. Mol. Microbiol. 75: 1215-1231.
    Pubmed PMC CrossRef
  28. Chen Z, Wang Y, Li Y, Li Y, Fu N, Ye J, et al. 2012. Esre: a novel essential non-coding RNA in Escherichia coli. FEBS Lett. 586: 1195-1200.
    Pubmed CrossRef
  29. Xia H, Yang X, Tang Q, Ye J, Wu H, Zhang H. 2017. EsrE-a yigP locus-encoded transcript-is a 3' UTR sRNA involved in the respiratory chain of E. coli. Front. Microbiol. 8: 1658.
    Pubmed PMC CrossRef
  30. Peschke U, Schmidt H, Zhang HZ, Piepersberg W. 1995. Molecular characterization of the lincomycin-production gene cluster of Streptomyces lincolnensis 78-11. Mol. Microbiol. 16: 1137-1156.
    Pubmed CrossRef
  31. Wang Y, Ye J, Zhang H. 2012. Identification of transcriptional regulatory sequences of yigP gene in Escherichia coli. Wei Sheng Wu Xue Bao 52: 566-572.
    Pubmed
  32. Jutras BL, Verma A, Stevenson B. 2012. Identification of novel DNA-binding proteins using DNA-affinity chromatography/pull down. Curr. Protoc. Microbiol. Chapter 1: Unit1F.1.
    Pubmed PMC CrossRef
  33. Bradford MM. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72: 248-254.
    Pubmed CrossRef
  34. Hempelmann E, Krafts K. 2017. The mechanism of silver staining of proteins separated by SDS polyacrylamide gel electrophoresis. Biotech. Histochem. 92: 79-85.
    Pubmed CrossRef
  35. Hou B, Lin Y, Wu H, Guo M, Petkovic H, Tao L, et al. 2018. The novel transcriptional regulator LmbU promotes lincomycin biosynthesis through regulating expression of its target genes in Streptomyces lincolnensis. J. Bacteriol. 200: e00447-17.
    Pubmed PMC CrossRef
  36. Datsenko KA, Wanner BL. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97: 6640-6645.
    Pubmed PMC CrossRef
  37. Hoopmann MR, Weisbrod CR, Bruce JE. 2010. Improved strategies for rapid identification of chemically cross-linked peptides using protein interaction reporter technology. J. Proteome. Res. 9: 6323-6333.
    Pubmed PMC CrossRef
  38. da Silva Neto JF, Braz VS, Italiani VC, Marques MV. 2009. Fur controls iron homeostasis and oxidative stress defense in the oligotrophic alpha-proteobacterium Caulobacter crescentus. Nucleic Acids Res. 37: 4812-4825.
    Pubmed PMC CrossRef
  39. Fillat MF. 2014. The FUR (ferric uptake regulator) superfamily: diversity and versatility of key transcriptional regulators. Arch. Biochem. Biophys. 546: 41-52.
    Pubmed CrossRef
  40. Seo SW, Kim D, Latif H, O'Brien EJ, Szubin R, Palsson BO. 2014. Deciphering Fur transcriptional regulatory network highlights its complex role beyond iron metabolism in Escherichia coli. Nat. Commun. 5: 4910.
    Pubmed PMC CrossRef
  41. Johnson M, Sengupta M, Purves J, Tarrant E, Williams PH, Cockayne A, et al. 2011. Fur is required for the activation of virulence gene expression through the induction of the sae regulatory system in Staphylococcus aureus. Int. J. Med. Microbiol. 301: 44-52.
    Pubmed PMC CrossRef
  42. Grunenwald CM, Choby JE, Juttukonda LJ, Beavers WN, Weiss A, Torres VJ, et al. 2019. Manganese detoxification by MntE is critical for resistance to oxidative stress and virulence of Staphylococcus aureus. MBio. 10. pii: e02915-18.
    Pubmed PMC CrossRef
  43. Troxell B, Hassan HM. 2013. Transcriptional regulation by Ferric Uptake Regulator (Fur) in pathogenic bacteria. Front. Cell Infect.Microbiol. 3: 59.
    Pubmed PMC CrossRef
  44. Massé E, Gottesman S. 2002. A small RNA regulates the expression of genes involved in iron metabolism in Escherichia coli. Proc. Natl. Acad. Sci. USA 99: 4620-4625.
    Pubmed PMC CrossRef
  45. Pannekoek Y, Huis In't Veld R, Schipper K, Bovenkerk S, Kramer G, Speijer D, et al. 2017. Regulation of Neisseria meningitidis cytochrome bc1 components by NrrF, a Fur-controlled small noncoding RNA. FEBS Open Bio. 7: 1302-1315.
    Pubmed PMC CrossRef
  46. Chen Z, Lewis KA, Shultzaberger RK, Lyakhov IG, Zheng M, Doan B, et al. 2007. Discovery of Fur binding site clusters in Escherichia coli by information theory models. Nucleic Acids Res. 35: 6762-6777.
    Pubmed PMC CrossRef

Related articles in JMB

More Related Articles

Article

Research article

J. Microbiol. Biotechnol. 2020; 30(1): 127-135

Published online January 28, 2020 https://doi.org/10.4014/jmb.1907.07026

Copyright © The Korean Society for Microbiology and Biotechnology.

sRNA EsrE Is Transcriptionally Regulated by the Ferric Uptake Regulator Fur in Escherichia coli

Bingbing Hou 1, 2, Xichen Yang 1, Hui Xia 1, Haizhen Wu 1, 2*, Jiang Ye 1, 2 and Huizhan Zhang 1, 2*

1State Key Laboratory of Bioreactor Engineering, East China University of Science and Technology, Shanghai, P.R.China, 2Department of Applied Biology, East China University of Science and Technology, Shanghai, P.R.China

Correspondence to:Haizhen  Wu, Huizhan  Zhang
wuhzh@ecust.edu.cn, huizhzh@ecust.edu.cn

Received: July 11, 2019; Accepted: November 5, 2019

Abstract

Small RNAs (sRNAs) are widespread and play major roles in regulation circuits in bacteria. Previously, we have demonstrated that transcription of esrE is under the control of its own promoter. However, the regulatory elements involved in EsrE sRNA expression are still unknown. In this study, we found that different cis-regulatory elements exist in the promoter region of esrE. We then screened and analyzed seven potential corresponding trans-regulatory elements by using pull-down assays based on DNA affinity chromatography. Among these candidate regulators, we investigated the relationship between the ferric uptake regulator (Fur) and the EsrE sRNA. Electrophoresis mobility shift assays (EMSAs) and β-galactosidase activity assays demonstrated that Fur can bind to the promoter region of esrE, and positively regulate EsrE sRNA expression in the presence of Fe2+.

Keywords: Small RNA, EsrE, DNA affinity chromatography, Fur, transcriptional regulation

Introduction

Bacteria can effectively respond to external environments and stresses through complex regulatory networks. Among such networks, regulatory sRNAs, ranging from 50-250 nucleotides, are widespread and play major roles in regulating translation of related mRNAs participating in biofilm formation, resistance stress, nutrient utilization, and so on [1-3]. Although the sequences of most sRNAs are not conserved among species, sRNAs are a universal phenomenon for genetic regulation in all bacteria [4]. Most known sRNAs function by forming base-pairing with the target mRNAs, affecting translation, stability, or processing of target mRNAs, thereby regulating expression of target genes [5-7]. Previous studies demonstrated that, besides the intergenic regions, sRNAs can also be derived from 5’ untranslated regions (UTRs) [8, 9], 3’ UTRs [10-12], intergenic regions [13], and antisense to coding regions [14, 15]. On the other hand, sRNA can not only be originated by processing of mRNAs [10, 16], but also be transcribed by independent promoters that are located in intergenic regions [17-19] or embedded in mRNA coding regions [20].

Typically, the expressions of sRNAs are regulated by diverse transcriptional regulators, which can directly sense biological signals or environmental changes [21]. RyhB is a well-studied sRNA existing in many bacteria, and functions as both a repressor and activator [22, 23]. Transcription of RyhB sRNA is repressed by an Fe2+-dependent regulator Fur, while translation of the upstream of the Fur translated region is downregulated by RyhB sRNA, making a feedback loop [24]. s-SodF is a short 3’-UTR processing product from sodF mRNA, which binds to sodN mRNA and causes its degradation. When nickel is sufficient, a Fur-family regulator Nur represses transcription of the sodF gene, resulting in a significant decrease of s-SodF sRNA [25]. FnrS is a highly conserved sRNA in various enterobacteria, and negatively regulates numerous mRNAs encoding enzymes involved in energy metabolism. Expression of FnrS is activated by two transcriptional regulators, FNR (fumarate and nitrate reduction) and ArcA (aerobic respiratory control), under anaerobic conditions [26, 27].

In our previous studies, we found a novel sRNA EsrE affects cell growth in E. coli [28]. Further studies demonstrated that EsrE is an independent transcript under the control of a promoter within the coding region of ubiJ (also known as yigP), and regulates multiple mRNAs that are involved in murein biosynthesis and the tricarboxylic acid cycle [29]. However, the relative transcriptional regulators and regulatory mechanisms of EsrE expression are still unknown. In this study, we demonstrated that Fur can bind to the promoter region of esrE, and positively regulate expression of EsrE sRNA in the presence of Fe2+.

Material and Methods

Bacterial Strains, Plasmids and Growth Conditions

The bacterial strains and plasmids used in this study are listed in Table 1. E. coli JM83 and E. coli BL21 (DE3) strains were used for routine molecular cloning and protein overexpression, respectively. Unless otherwise stated, the strains were routinely grown at 37 °C in liquid or solid Luria-Bertani (LB) medium supplemented with ampicillin (100 μg/ml), kanamycin (50 μg/ml), or chloramphenicol (30 μg/ml), as appropriate.

Table 1 . Strains and plasmids used in this study..

Strains or plasmidsGenotype and/or descriptionSource or reference
Strains
E. coli
JM83F’, ara, Δ(lac-pro AB), rpsL, (Strr), Φ80, lacZΔM15
BL21 (DE3)F- ompT hsdS gal dcmNovagen
ΔfurJM83, in-frame deletion in the fur gene, AmrThis study
Plasmids
pSPORT1Plasmid vector, Apr, lacZ-Stratagene
pSP-Z3.1 kb PstI/BamHI fragment containing the lacZ gene in pSPORT1, AprThis study
pSZ1pSP-Z carrying the lacZ reporter gene controlled by S1V3This study
pPZ40pSP-Z carrying the lacZ reporter gene controlled by P40V3This study
pPZ42pSP-Z carrying the lacZ reporter gene controlled by P42V3This study
pPZ43pSP-Z carrying the lacZ reporter gene controlled by P43V3This study
pET-28a (+)E. coli expression vectorNovagen



Construction of lacZ Reporter Plasmids

The promoter-probe plasmid pSP-Z was used to construct reporter plasmids in this work, and was derived from pSPORT1 [30], carrying a 3.1 kb PstI/BamHI fragment containing the lacZ gene as a reporter. Promoter fragments, S1V3, P40V3, P42V3, and P43V3, were amplified using primer pairs S1/V3, P40/V3, P42/V3, and P43/V3 (Table 2) with genomic DNA from E. coli JM83 as templates, respectively. The purified fragments were digested with HindIII and NcoI, and ligated into the HindIII/NcoI-restricted pSP-Z vector, resulting in reporter plasmids pSZ1, pPZ40, pPZ42, and pPZ43, where the lacZ gene is under the control of a series of promoter fragments of different lengths.

Table 2 . Primers used in this study..

PrimersSequence(5' to 3')
Construction of the recombinant proteins
S1CCCAAGCTTTGCACCGTTATCGCCTACGCCAGTG
P40GAAGCTTACCGCACTGATTCG
P42CCCAAGCTTTGCAGGGCGATATTCAG
P43CCCAAGCTTGTGGTGCAAAACTTCG
V3GATTCCTCCATGGGCGATATCACCG
PD*-1Biotin-TGCACCGTTATCGCCTACGC
PD-1TGCACCGTTATCGCCTACGC
PD-2GCGATATCACCGGTATAAGG
DZ*-1Biotin-GCAAAGCCATGCGCGGAGGC
DZ-1GCAAAGCCATGCGCGGAGGC
DZ-2CAGTTTTTCCAGCCGTTTGG
Fur-1CGCCATATGATGACTGATAACAATACC
Fur-2CCGGAATTCTTATTTGCCTTCGTGCG
fur-QC1ATGACTGATAACAATACCGCCCTAAAGAAAGCTGGCCTGATTCCGGGGATCCGTCGACC
fur-QC2TTATTTGCCTTCGTGCGCATGTTCATCTTCGCGGCAATCGTGTAGGCTGGAGCTGCTTC
fur-JD1TTGCCAGGGACTTGTGGT
fur-JD2CTGGCAGGAAATACGCAG



β-Galactosidase Activity Assays

The reporter plasmids were introduced into E. coli wild-type strain JM83 or mutant Δfur as appropriate. β-galactosidase assays were performed as described in our previous work [31]. E. coli strains were cultivated in liquid LB medium at 37°C until reaching an optical density at 600 nm of approximately 2. Cells (3OD for each strain) were harvested and suspended in 300 μl of 100 mM phosphate-buffered saline (PBS) buffer. Then, the cells were lysed by sonication for 3 min and centrifuged for 30 min at 4°C to remove cellular debris, resulting in cell extracts. The reaction mixture included 3 μl of 100 × MgCl2 solution (20 μl of 1 M MgCl2, 63 μl of 14.3 M β-mercaptoethanol, 117 μl of ddH2O), 66 μl of substrate solution (60 mM Na2HPO4, 40 mM NaH2PO4, 1 mg/ml o-nitro-phenyl-β-D-galactopyranoside, and 2.7 μl/ml β-mercaptoethanol), 131 μl of 100 mM PBS, and 100 μl of cell extract. After 30 min at 30°C, reactions were terminated by adding 500 μl of 1M Na2CO3. The optical density at 420 nm was detected, and the enzyme activities were calculated as the change per minute per OD unit of culture present in the assays and converted into Miller units.

DNA Affinity Chromatography

DNA affinity chromatography was performed as previously described [32] with the following modifications. DNA probes with the biotin at the 5’ end, biotin-S1V3 and biotin-ORF (negative control), were generated by PCR using primer pairs PD*-1/PD-2 and DZ*-1/DZ-2 (Table 2), respectively. The concentration and quality of the probes were analyzed by using a spectrophotometer NanoDrop 2000. Total proteins were obtained as outlined above (β-galactosidase activity assays), analyzed using 12% SDS-polyacrylamide gel electrophoresis (SDS-PAGE), and were quantified through the Bradford assay [33].

DNA probes were immobilized to M-280 Dynabeads (Invitrogen, USA) using the method recommended by the manufacturer. Briefly, streptavidin Dynabeads were washed three times and suspended in buffer A (50 mM Tris-HCl pH 7.5, 0.5 mM EDTA, 1 mM DTT, and 1 M NaCl). The DNA probes were incubated with the beads for 30 min at room temperature. Subsequently, buffer A and protein-binding buffer B (20 mM Tris-HCl pH 8.0, 1 mM EDTA, 1 mM DTT, 100 mM NaCl, and 10% glycerol) were successively used to wash the DNA-bead complex for three times. After incubation with the cell extracts for 1 h at room temperature with shaking at 350 rpm, the magnetic particles were washed three times with buffer B to remove unbound proteins. The DNA-binding proteins were eluted by elution buffer C with different concentrations of NaCl (25 mM Tris-HCl pH 8.0 and 200 mM/ 500 mM/1 M NaCl), and finally DNase I was added to the reaction mixture. The eluted fractions were subjected to SDS-PAGE, and visualized using silver staining.

The silver staining method is sensitive for visualizing low-abundance proteins [34]. The gel was cleaned with deionized water for 5-10 min, and fixed in fixative buffer (30% ethanol and 10% acetic acid) for at least 2 h. After washing with 10% ethanol solution twice, the gel was sensitized in 0.02% sodium thiosulphate solution for 1 min, followed by incubation in 0.1% (w/v) silver nitrate solution for 20 min. Subsequently, the gel was briefly washed twice with deionized water and immersed in developing solution (2% Na2CO3 and 0.04% formaldehyde) until the protein bands could be observed clearly. Finally, the reaction was were terminated by adding 5% acetic acid solution. The protein bands of interest were excised from the gel with a scalpel, and sent to Applied Protein Technology (ATP, China) for trypsin digestion and mass spectrometry.

Construction, Overexpression and Purification of Fur

The fur gene was amplified by PCR using the primer pairs Fur-1/2 in Table 2, and inserted into the pET-28a (+) vector after digestion with NdeI/EcoRI, resulting in expression plasmids pFUR. The obtained plasmid was transformed into E. coli BL21 (DE3) for protein expression. The strain was cultivated at 37ºC until the OD600 reached about 0.6, and IPTG was added to a final concentration of 0.5 mM. Subsequently, the culture was incubated at 16ºC overnight.

The cell pellets were collected by centrifugation, washed twice with phosphate buffer, and re-suspended in the same buffer. The proteins were released by sonication on ice, and purified using Ni-iminodiacetic acid agarose chromatography (WeiShiBoHui, China). The purified protein was desalted by molecular exclusion chromatography using G25. The purified Fur protein was analyzed using 12% SDS-PAGE, and quantified using the Bradford assay.

Electrophoresis Mobility Shift Assays (EMSA)

DNA probe Biotin-S1V3 was amplified by PCR using primer pairs PD*-1/PD-2, and an unlabeled DNA fragment was amplified by PCR using primer pairs PD-1/PD-2 (Table 2). EMSAs were carried out as described in our previous work [35], using chemiluminescent EMSA kits (Beyotime Biotechnology, China). The binding reaction mixture contained 10 mM Tris-HCl pH 7.5, 50 mM KCl, 0.5 mM DTT, 0.05 mg/ml BSA, 4% glycerin, 1 mM MgCl2, 0.1 mM MnCl2, 10 ng of DNA probe, 50 μg/ml poly(dI-dC), and appropriate His6-Fur protein.

Inactivation of the fur Gene

The λ Red-mediated recombination method was used to construct a fur inactivation strain [36]. A 1.4 kb disruption fragment containing the apramycin resistance gene was amplified using primer pairs fur-QC1/QC2, each of which has a 5’ sequence (39 nt) matching the JM83 sequence adjacent to the fur gene to be inactivated. The disruption fragment was transferred to E. coli JM83 by electroporation. The internal region of the fur gene was replaced with apramycin resistance gene by λ Red-mediated recombination, to obtain the fur inactivation strain, which was identified by PCR using the primer pairs fur-JD1/JD2.

Results

The Promoter Region of esrE Contains Several cis-Regulatory Elements

In our previous study, we have demonstrated that the esrE gene encodes a non-coding sRNA, which is controlled by its own promoter [28]. To further investigate the relevant regulation of EsrE expression, we analyzed the cis-regulatory elements upstream of the esrE gene. A series of fragments, S1V3, P40V3, P42V3 and P43V3, were amplified and fused to the lacZ reporter gene to carry out β-galactosidase activity assays (Figs. 1A and 1B). The data showed that β-galactosidase activity driven by P42V3 was significantly decreased compared to that driven by P43V3 and P40V3, suggesting the fragment P42-P43 contains negative regulatory element(s), and the fragment P40-P42 contains positive regulatory element(s) (Fig. 1C). Moreover, the β-galactosidase activity driven by S1V3 was decreased compared to that drove by P40V3, suggesting the fragment S1-P40 contains negative regulatory element(s) as well (Fig. 1C). Thus, we demonstrated that several cis-regulatory elements exist upstream of the esrE gene.

Figure 1. Analysis and identification of the cis-regulatory elements within the promoter region of esrE. (A) Schematic representation and sequence analysis of the esrE gene and its promoter region. The -35 and -10 boxes are indicated by hollow boxes, and the transcription start site (TSS) is indicated by an orange arrowhead. Primers (S1, P40, P42, P43, and V3) are indicated by horizontal arrows. (B) Locations of different length fragments in the upstream region flanking the esrE gene. (C) Basal transcriptional activities of esrE promoter fragments of various lengths in E. coli JM83. Bars correspond to the mean ± SD of three biological replicates. **p < 0.01, ***p < 0.001.

Corresponding Trans-Regulatory Elements Are Identified by Pull Down

To identify the corresponding trans-regulatory elements involved in transcription of the esrE gene, proteins binding to the promoter region of esrE were screened by pull-down assays based on DNA affinity chromatography. A biotin-labeled DNA probe S1V3 (designated Biotin-PesrE, 188 bp) was used as bait, and another biotin-labeled DNA fragment within the esrE coding region (designated Biotin-ORF, 188 bp) was used as a negative control (Fig. 2A). The affinity captured proteins were analyzed using SDS-PAGE, and visualized by silver staining. The results showed that five distinguishing protein bands with molecular weights from 14 kDa to 44 kDa were observed in lines 3 and 5 for the Biotin-PesrE probe, compared to Biotin-ORF (Fig. 2B, arrow indicated).

Figure 2. Screening for PesrE binding proteins. (A) Locations of the DNA probe Biotin-PesrE and Biotin-ORF. The primer pairs PD1*/2 and DZ1*/2 are indicated by horizontal arrows. +1 indicates the TSS of esrE. Asterisks indicate biotin-labeled. (B) SDS-PAGE of proteins analyzed through DNA affinity chromatography using Biotin-PesrE as bait and Biotin-ORF as a negative control. Proteins that bound to the Biotin-PesrE probe (lanes 1, 3, 5, and 7), and the Biotin-ORF fragment (lanes 2, 4, 6, and 8) were separated by SDSPAGE and visualized through silver staining. Proteins that specifically bound to the Biotin-PesrE probe are indicated by arrows. Lane M, protein molecular weight marker. Lanes 1 and 2, eluate by 200 mM NaCl; Lanes 3 and 4, eluate by 500 mM NaCl; Lanes 5 and 6, eluate by 1 M NaCl; Lanes 7 and 8, eluate treated with DNase I.

Subsequently, the five selected protein bands were excised from the gel and subjected to tryptic digestion together. To identify the candidate proteins, MALDI-TOF and a peptide fingerprint analysis were performed, and the obtained peptide mass patterns were compared with the proteome of E. coli K-12 using MASCOT 2.2 software [37]. As a result, 7 potential DNA-binding proteins were identified excluding the ribosomal proteins and the contaminant proteins with incorrect, higher molecular weight (Tables S1 and 3).

Table 3 . Candidate DNA-binding proteins identified by DNA affinity chromatography and mass spectrometry..

ProteinAccession NumberProtein descriptionMW/kDa
GntRYP_026222.1D-gluconate inducible gluconate regulon transcriptional repressor36
RdgCNP_414927.1Nucleoid-associated ssDNA and dsDNA binding protein34
UidRNP_416135.1DNA-binding transcriptional repressor22
SeqANP_415213.1Negative modulator of initiation of replication20
DpsNP_415333.1Stress-inducible DNA-binding protein19
DicANP_416088.1Qin prophage predicted regulator for DicB17
FurNP_415209.1Ferric uptake regulation protein17



Fur Functions as a PesrE-Interactive Regulator

We first screened the 7 potential proteins by performing β-galactosidase activity assays, and the data showed that these proteins do not regulate the promoter PesrE in vivo (Fig. S1). Among these candidate regulators, Fur is a global transcriptional regulator found in most bacteria. Considering the regulation of Fur may need cofactors, thus we chose Fur for further study. To confirm the DNA-binding activity of Fur to PesrE, His6-Fur protein (19-kDa) was overexpressed, purified, and analyzed by SDS-PAGE (Fig. 3A). Then EMSA analysis was carried out using the purified His6-Fur with the DNA probe Biotin-PesrE in the presence of Mg2+ and Mn2+. The data showed that His6-Fur could bind to Biotin-PesrE and generate significantly shifted bands in a concentration-dependent manner (Fig. 3B). The DNA-binding specificity was evaluated by the addition of excess unlabeled specific probe (PesrE), in which the shifted bands disappeared (Fig. 3B, the last lane), suggesting that His6-Fur specifically binds to PesrE in vitro. Furthermore, to investigate the effects of Mg2+ and Mn2+ on the DNA-binding of Fur, EMSAs under different conditions were performed. The results showed that Fur can bind to PesrE without divalent metal ions, while Mg2+ can facilitate the binding of Fur and PesrE (Fig. 3C). These data are consistent with the results of the pull-down assays, indicating that Fur can directly bind to the promoter region of the esrE gene.

Figure 3. Binding of His6-Fur to the promoter region of esrE. (A) Expression and purification of His6-Fur proteins. 1, 2, and 3 indicated proteins eluted by 100, 150, and 200 mM imidazole solution respectively. P indicated precipitation after ultrasonication, S indicated supernatant after ultrasonication, + indicated total proteins from cells induction, and - indicated total proteins from cells without induction. (B) EMSA analysis of His6-Fur to PesrE. Biotin-labeled probes Biotin-PesrE (188 bp, 10 ng) were incubated with increasing concentrations of purified His6-Fur (0, 0.52, 1.04, 3.12, 5.20, and 7.28 μM). 100-fold excess of unlabeled specific competitor PesrE was added as control to confirm the specificity of the band shifts. The free probes and DNA-protein complexes are indicated by arrows. (C) EMSA analysis of His6-Fur to PesrE under different conditions. The concentrations of Mg2+ and Mn2+ used in EMSA were 1 mM and 0.1 mM, respectively.

Fur Positively Regulates the PesrE Promoter when the Cofactor Fe2+ Is Present

To further define the effect of Fur on the activity of the PesrE promoter in vivo, we constructed a Fur mutant Δfur in which the internal region of the fur gene was replaced by a apramycin resistance cassette. Then the PesrE fragment was amplified and fused to the lacZ gene to construct reporter plasmid, which was introduced into both the wild-type strain JM83 and the mutant Δfur respectively. Subsequent reporter assays were carried out under different culture conditions, in which Fe2+ or the iron-chelator dipyridyl was added or not [38]. The results showed that there was no significant difference in the β-galactosidase relative activity between JM83 and Δfur when iron-chelator dipyridyl was added, which is consistent with the result without any additive (Fig. 4). However, the β-galactosidase relative activity was lower in Δfur compared to JM83 when Fe2+ was added, indicating that Fur activates the PesrE promoter when the cofactor Fe2+ is present.

Figure 4. Reporter assays of the effect of Fur on the activity of the PesrE promoter under different conditions. NT showed no additive was added. FeSO4 showed Fe2+ (100 μM) was added. Dipyridyl showed iron-chelator dipyridyl (100 μM) was added, but Fe2+ was not added. WT, wild-type strain JM83, Δfur, fur inactivation strain. Bars correspond to the mean ± SD of three biological replicates, ***p < 0.001.

Inactivation of the fur Gene Inhibits the Growth of E. coli

It has been shown that Fur functions as a global regulator, which is involved in many cellular processes. In addition, our previous studies demonstrated that EsrE sRNA, the target of Fur, is required for aerobic growth of E. coli [29]. In view of this, we investigated the effect of Fur on cell growth of JM83. Both strains JM83 and Δfur were cultured and analyzed on solid LB medium and in liquid LB medium respectively. The data revealed that Δfur mutant forms smaller colonies than the wild-type strain JM83 (Fig. 5A), meanwhile, the mutant exhibits retarded growth compared to the wild-type JM83 in liquid LB medium (Fig. 5B), indicating deletion of the fur gene also affects cell growth of JM83.

Figure 5. Cell growth analysis of fur inactivation strain. Wild-type (WT) and Δfur strains were grown on solid LB plates (A) and liquid LB medium (B) respectively. The experiments were performed at least 3 times, and the identical patterns were represent.

Discussion

In our previous study, we have shown that expression of EsrE sRNA is under the control of its own promoter [28, 29]. Here, we performed further studies to analyze the regulatory mechanism of EsrE sRNA expression and identify the corresponding trans-regulatory elements.

The transcriptional factor Fur has been widely researched in recent years, and functions as a global transcriptional regulator that plays an important role in modulating expression of the genes involved in iron uptake, oxidative stresses, biofilm formation and virulence in various species [39-42]. Fur can function as a repressor which inhibits the binding of the RNA polymerase holoenzyme (RNAP), and also function as an activator through sRNA regulation, RNAP recruitment or antirepressor mechanism [43]. It has been shown that Fur can regulate a number of genes through the regulation of sRNA at the posttranscriptional level. For instance, Fur represses the expression of RyhB sRNA, which downregulates at least six mRNAs encoding iron-binding proteins, including sdhCDAB operon encoding succinate dehydrogenase in E. coli [44]. Moreover, sdhCDAB is regulated by NrrF sRNA as well, the expression of which is controlled by Fur in the human pathogen Neisseria meningitidis [45]. Thus, this phenomenon is common in the regulatory network of bacteria, showing that bacteria can regulate the expression of genes in cells layer by layer, and control their metabolism reasonably and effectively. Previously, we showed that EsrE sRNA upregulates the expression of sdhD and is required for succinate dehydrogenase activity in E. coli [29]. Here, we demonstrated that Fur positively regulates the expression of EsrE sRNA by binding to the promoter region of esrE directly (Figs. 3 and 4), indicating that a similar phenomenon of cascade regulation also exists in Fur, EsrE sRNA and sdhCDAB. In addition, the recognition mechanism of Fur to the targets has been found conserved in distantly related species, such as E. coli, Pseudomonas aeruginosa and Bacillus subtilis, and the binding sites of Fur are AT-rich boxes (Fur box) [46]. However, although the promoter region of esrE contains several AT-rich motifs (Fig. 1A), it lacks a typical Fur box. Thus, further studies will be performed to reveal the explicit relationships and the specific mechanisms among Fur, EsrE sRNA, sdhCDAB and the corresponding cell phenotype.

In addition, the results of β-galactosidase activity assay showed that at least one negative and one positive cis-regulatory element are involved in transcriptional regulation of the esrE promoter (Fig. 1C), indicating there may be one or more corresponding trans-regulatory elements. Accordingly, pull-down assays illustrated that there are several candidate PesrE-interactive regulators besides Fur (Fig. 2 and Table 3). These data demonstrated that the regulatory mechanism of EsrE sRNA expression is complicated. In subsequent studies, we will continue to analyze the other regulators and the physiological signals to which EsrE sRNA responds.

In conclusion, this report demonstrated that Fur regulates EsrE sRNA expression and shed light on the regulation of EsrE for the first time. Our results elaborate the relationship among Fur, EsrE sRNA, and sdhCDAB operon, and thus contribute to the illustration of the ecological behavior of the bacteria.

Supplemental Materials

Acknowledgments

This work was supported by the National Natural Science Foundation of China (Grant Numbers 31372550, 3120026, and 31070073).

Conflict of Interest

The authors have no financial conflicts of interest to declare.

Fig 1.

Figure 1.Analysis and identification of the cis-regulatory elements within the promoter region of esrE. (A) Schematic representation and sequence analysis of the esrE gene and its promoter region. The -35 and -10 boxes are indicated by hollow boxes, and the transcription start site (TSS) is indicated by an orange arrowhead. Primers (S1, P40, P42, P43, and V3) are indicated by horizontal arrows. (B) Locations of different length fragments in the upstream region flanking the esrE gene. (C) Basal transcriptional activities of esrE promoter fragments of various lengths in E. coli JM83. Bars correspond to the mean ± SD of three biological replicates. **p < 0.01, ***p < 0.001.
Journal of Microbiology and Biotechnology 2020; 30: 127-135https://doi.org/10.4014/jmb.1907.07026

Fig 2.

Figure 2.Screening for PesrE binding proteins. (A) Locations of the DNA probe Biotin-PesrE and Biotin-ORF. The primer pairs PD1*/2 and DZ1*/2 are indicated by horizontal arrows. +1 indicates the TSS of esrE. Asterisks indicate biotin-labeled. (B) SDS-PAGE of proteins analyzed through DNA affinity chromatography using Biotin-PesrE as bait and Biotin-ORF as a negative control. Proteins that bound to the Biotin-PesrE probe (lanes 1, 3, 5, and 7), and the Biotin-ORF fragment (lanes 2, 4, 6, and 8) were separated by SDSPAGE and visualized through silver staining. Proteins that specifically bound to the Biotin-PesrE probe are indicated by arrows. Lane M, protein molecular weight marker. Lanes 1 and 2, eluate by 200 mM NaCl; Lanes 3 and 4, eluate by 500 mM NaCl; Lanes 5 and 6, eluate by 1 M NaCl; Lanes 7 and 8, eluate treated with DNase I.
Journal of Microbiology and Biotechnology 2020; 30: 127-135https://doi.org/10.4014/jmb.1907.07026

Fig 3.

Figure 3.Binding of His6-Fur to the promoter region of esrE. (A) Expression and purification of His6-Fur proteins. 1, 2, and 3 indicated proteins eluted by 100, 150, and 200 mM imidazole solution respectively. P indicated precipitation after ultrasonication, S indicated supernatant after ultrasonication, + indicated total proteins from cells induction, and - indicated total proteins from cells without induction. (B) EMSA analysis of His6-Fur to PesrE. Biotin-labeled probes Biotin-PesrE (188 bp, 10 ng) were incubated with increasing concentrations of purified His6-Fur (0, 0.52, 1.04, 3.12, 5.20, and 7.28 μM). 100-fold excess of unlabeled specific competitor PesrE was added as control to confirm the specificity of the band shifts. The free probes and DNA-protein complexes are indicated by arrows. (C) EMSA analysis of His6-Fur to PesrE under different conditions. The concentrations of Mg2+ and Mn2+ used in EMSA were 1 mM and 0.1 mM, respectively.
Journal of Microbiology and Biotechnology 2020; 30: 127-135https://doi.org/10.4014/jmb.1907.07026

Fig 4.

Figure 4.Reporter assays of the effect of Fur on the activity of the PesrE promoter under different conditions. NT showed no additive was added. FeSO4 showed Fe2+ (100 μM) was added. Dipyridyl showed iron-chelator dipyridyl (100 μM) was added, but Fe2+ was not added. WT, wild-type strain JM83, Δfur, fur inactivation strain. Bars correspond to the mean ± SD of three biological replicates, ***p < 0.001.
Journal of Microbiology and Biotechnology 2020; 30: 127-135https://doi.org/10.4014/jmb.1907.07026

Fig 5.

Figure 5.Cell growth analysis of fur inactivation strain. Wild-type (WT) and Δfur strains were grown on solid LB plates (A) and liquid LB medium (B) respectively. The experiments were performed at least 3 times, and the identical patterns were represent.
Journal of Microbiology and Biotechnology 2020; 30: 127-135https://doi.org/10.4014/jmb.1907.07026

Table 1 . Strains and plasmids used in this study..

Strains or plasmidsGenotype and/or descriptionSource or reference
Strains
E. coli
JM83F’, ara, Δ(lac-pro AB), rpsL, (Strr), Φ80, lacZΔM15
BL21 (DE3)F- ompT hsdS gal dcmNovagen
ΔfurJM83, in-frame deletion in the fur gene, AmrThis study
Plasmids
pSPORT1Plasmid vector, Apr, lacZ-Stratagene
pSP-Z3.1 kb PstI/BamHI fragment containing the lacZ gene in pSPORT1, AprThis study
pSZ1pSP-Z carrying the lacZ reporter gene controlled by S1V3This study
pPZ40pSP-Z carrying the lacZ reporter gene controlled by P40V3This study
pPZ42pSP-Z carrying the lacZ reporter gene controlled by P42V3This study
pPZ43pSP-Z carrying the lacZ reporter gene controlled by P43V3This study
pET-28a (+)E. coli expression vectorNovagen


Table 2 . Primers used in this study..

PrimersSequence(5' to 3')
Construction of the recombinant proteins
S1CCCAAGCTTTGCACCGTTATCGCCTACGCCAGTG
P40GAAGCTTACCGCACTGATTCG
P42CCCAAGCTTTGCAGGGCGATATTCAG
P43CCCAAGCTTGTGGTGCAAAACTTCG
V3GATTCCTCCATGGGCGATATCACCG
PD*-1Biotin-TGCACCGTTATCGCCTACGC
PD-1TGCACCGTTATCGCCTACGC
PD-2GCGATATCACCGGTATAAGG
DZ*-1Biotin-GCAAAGCCATGCGCGGAGGC
DZ-1GCAAAGCCATGCGCGGAGGC
DZ-2CAGTTTTTCCAGCCGTTTGG
Fur-1CGCCATATGATGACTGATAACAATACC
Fur-2CCGGAATTCTTATTTGCCTTCGTGCG
fur-QC1ATGACTGATAACAATACCGCCCTAAAGAAAGCTGGCCTGATTCCGGGGATCCGTCGACC
fur-QC2TTATTTGCCTTCGTGCGCATGTTCATCTTCGCGGCAATCGTGTAGGCTGGAGCTGCTTC
fur-JD1TTGCCAGGGACTTGTGGT
fur-JD2CTGGCAGGAAATACGCAG


Table 3 . Candidate DNA-binding proteins identified by DNA affinity chromatography and mass spectrometry..

ProteinAccession NumberProtein descriptionMW/kDa
GntRYP_026222.1D-gluconate inducible gluconate regulon transcriptional repressor36
RdgCNP_414927.1Nucleoid-associated ssDNA and dsDNA binding protein34
UidRNP_416135.1DNA-binding transcriptional repressor22
SeqANP_415213.1Negative modulator of initiation of replication20
DpsNP_415333.1Stress-inducible DNA-binding protein19
DicANP_416088.1Qin prophage predicted regulator for DicB17
FurNP_415209.1Ferric uptake regulation protein17


References

  1. Wagner EGH, Romby P. 2015. Small RNAs in bacteria and archaea: who they are, what they do, and how they do it. Adv. Genet. 90: 133-208.
    Pubmed CrossRef
  2. Melamed S, Peer A, Faigenbaum-Romm R, Gatt YE, Reiss N, Bar A, et al. 2016. Global mapping of small RNA-target interactions in bacteria. Mol. Cell. 63: 884-897.
    Pubmed KoreaMed CrossRef
  3. Frohlich KS, Gottesman S. 2018. Small regulatory RNAs in the enterobacterial response to envelope damage and oxidative stress. Microbiol. Spectr. 6: RWR-22.
    Pubmed KoreaMed CrossRef
  4. Kavita K, de Mets F, Gottesman S. 2018. New aspects of RNA-based regulation by Hfq and its partner sRNAs. Curr. Opin. Microbiol. 42: 53-61.
    Pubmed CrossRef
  5. Gimpel M, Brantl S. 2016. Dual-function sRNA encoded peptide SR1P modulates moonlighting activity of B. subtilis GapA. RNA Biol. 13: 916-926.
    Pubmed KoreaMed CrossRef
  6. Evguenieva-Hackenberg E, Klug G. 2011. New aspects of RNA processing in prokaryotes. Curr. Opin. Microbiol. 14: 587-592.
    Pubmed CrossRef
  7. Klein G, Raina S. 2017. Small regulatory bacterial RNAs regulating the envelope stress response. Biochem. Soc. Trans. 45: 417-425.
    Pubmed KoreaMed CrossRef
  8. Klein G, Stupak A, Biernacka D, Wojtkiewicz P, Lindner B, Raina S. 2016. Multiple transcriptional factors regulate transcription of the rpoE gene in Escherichia coli under different growth conditions and when the lipopolysaccharide biosynthesis is defective. J. Biol. Chem. 291: 22999-23019.
    Pubmed KoreaMed CrossRef
  9. Zhang Y, Yan D, Xia L, Zhao X, Osei-Adjei G, Xu S, et al. 2017. The malS-5'UTR regulates hisG, a key gene in the histidine biosynthetic pathway in Salmonella enterica serovar Typhi. Can. J. Microbiol. 63: 287-295.
    Pubmed CrossRef
  10. Chao Y, Vogel J. 2016. A 3' UTR-derived small RNA provides the regulatory noncoding arm of the inner membrane stress response. Mol. Cell 61: 352-363.
    Pubmed CrossRef
  11. Klein G, Kobylak N, Lindner B, Stupak A, Raina S. 2014. Assembly of lipopolysaccharide in Escherichia coli requires the essential LapB heat shock protein. J. Biol. Chem. 289: 14829-14853.
    Pubmed KoreaMed CrossRef
  12. Zhao X, Liu R, Tang H, Osei-Adjei G, Xu S, Zhang Y, et al. 2018. A 3' UTR-derived non-coding RNA RibS increases expression of cfa and promotes biofilm formation of Salmonella enterica serovar Typhi. Res. Microbiol. 169: 279-288.
    Pubmed CrossRef
  13. Kroger C, Rothhardt JE, Brokatzky D, Felsl A, Kary SC, Heermann R, et al. 2018. The small RNA RssR regulates myo-inositol degradation by Salmonella enterica. Sci. Rep. 8: 17739.
    Pubmed KoreaMed CrossRef
  14. Georg J, Hess WR. 2011. cis-antisense RNA, another level of gene regulation in bacteria. Microbiol. Mol. Biol. Rev. 75: 286-300.
    Pubmed KoreaMed CrossRef
  15. Georg J, Hess WR. 2018. Widespread antisense transcription in prokaryotes. Microbiol. Spectr. 6: RWR-29.
    Pubmed CrossRef
  16. Manna AC, Kim S, Cengher L, Corvaglia A, Leo S, Francois P, et al. 2018. Small RNA teg49 is derived from a sarA transcript and regulates virulence genes independent of SarA in Staphylococcus aureus. Infect. Immun. 86. pii: e00635-17.
    Pubmed KoreaMed CrossRef
  17. Argaman L, Hershberg R, Vogel J, Bejerano G, Wagner EG, Margalit H, et al. 2001. Novel small RNA-encoding genes in the intergenic regions of Escherichia coli. Curr. Biol. 11: 941-950.
    Pubmed CrossRef
  18. Saito S, Kakeshita H, Nakamura K. 2009. Novel small RNA-encoding genes in the intergenic regions of Bacillus subtilis. Gene 428: 2-8.
    Pubmed CrossRef
  19. Baekkedal C, Haugen P. 2015. The Spot 42 RNA: a regulatory small RNA with roles in the central metabolism. RNA Biol. 12: 1071-1077.
    Pubmed KoreaMed CrossRef
  20. Guo MS, Updegrove TB, Gogol EB, Shabalina SA, Gross CA, Storz G. 2014. MicL, a new σE-dependent sRNA, combats envelope stress by repressing synthesis of Lpp, the major outer membrane lipoprotein. Genes Dev. 28: 1620-1634.
    Pubmed KoreaMed CrossRef
  21. Beisel CL, Storz G. 2010. Base pairing small RNAs and their roles in global regulatory networks. FEMS Microbiol. Rev. 34: 866-882.
    Pubmed KoreaMed CrossRef
  22. Mandin P, Chareyre S, Barras F. 2016. A regulatory circuit composed of a transcription factor, IscR, and a regulatory RNA, RyhB, controls Fe-S cluster delivery. MBio. 7: e00966-16.
    Pubmed KoreaMed CrossRef
  23. Prevost K, Salvail H, Desnoyers G, Jacques JF, Phaneuf E, Masse E. 2007. The small RNA RyhB activates the translation of shiA mRNA encoding a permease of shikimate, a compound involved in siderophore synthesis. Mol. Microbiol. 64: 1260-1273.
    Pubmed CrossRef
  24. Vecerek B, Moll I, Blasi U. 2007. Control of Fur synthesis by the non-coding RNA RyhB and iron-responsive decoding. EMBO J. 26: 965-975.
    Pubmed KoreaMed CrossRef
  25. Kim HM, Shin JH, Cho YB, Roe JH. 2014. Inverse regulation of Fe- and Ni-containing SOD genes by a Fur family regulator Nur through small RNA processed from 3'UTR of the sodF mRNA. Nucleic Acids Res. 42: 2003.
    Pubmed KoreaMed CrossRef
  26. Tanwer P, Bauer S, Heinrichs E, Panda G, Saluja D, Rudel T, Beier D. 2017. Post-transcriptional regulation of target genes by the sRNA FnrS in Neisseria gonorrhoeae. Microbiology 163: 1081-1092.
    Pubmed CrossRef
  27. Durand S, Storz G. 2010. Reprogramming of anaerobic metabolism by the FnrS small RNA. Mol. Microbiol. 75: 1215-1231.
    Pubmed KoreaMed CrossRef
  28. Chen Z, Wang Y, Li Y, Li Y, Fu N, Ye J, et al. 2012. Esre: a novel essential non-coding RNA in Escherichia coli. FEBS Lett. 586: 1195-1200.
    Pubmed CrossRef
  29. Xia H, Yang X, Tang Q, Ye J, Wu H, Zhang H. 2017. EsrE-a yigP locus-encoded transcript-is a 3' UTR sRNA involved in the respiratory chain of E. coli. Front. Microbiol. 8: 1658.
    Pubmed KoreaMed CrossRef
  30. Peschke U, Schmidt H, Zhang HZ, Piepersberg W. 1995. Molecular characterization of the lincomycin-production gene cluster of Streptomyces lincolnensis 78-11. Mol. Microbiol. 16: 1137-1156.
    Pubmed CrossRef
  31. Wang Y, Ye J, Zhang H. 2012. Identification of transcriptional regulatory sequences of yigP gene in Escherichia coli. Wei Sheng Wu Xue Bao 52: 566-572.
    Pubmed
  32. Jutras BL, Verma A, Stevenson B. 2012. Identification of novel DNA-binding proteins using DNA-affinity chromatography/pull down. Curr. Protoc. Microbiol. Chapter 1: Unit1F.1.
    Pubmed KoreaMed CrossRef
  33. Bradford MM. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72: 248-254.
    Pubmed CrossRef
  34. Hempelmann E, Krafts K. 2017. The mechanism of silver staining of proteins separated by SDS polyacrylamide gel electrophoresis. Biotech. Histochem. 92: 79-85.
    Pubmed CrossRef
  35. Hou B, Lin Y, Wu H, Guo M, Petkovic H, Tao L, et al. 2018. The novel transcriptional regulator LmbU promotes lincomycin biosynthesis through regulating expression of its target genes in Streptomyces lincolnensis. J. Bacteriol. 200: e00447-17.
    Pubmed KoreaMed CrossRef
  36. Datsenko KA, Wanner BL. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97: 6640-6645.
    Pubmed KoreaMed CrossRef
  37. Hoopmann MR, Weisbrod CR, Bruce JE. 2010. Improved strategies for rapid identification of chemically cross-linked peptides using protein interaction reporter technology. J. Proteome. Res. 9: 6323-6333.
    Pubmed KoreaMed CrossRef
  38. da Silva Neto JF, Braz VS, Italiani VC, Marques MV. 2009. Fur controls iron homeostasis and oxidative stress defense in the oligotrophic alpha-proteobacterium Caulobacter crescentus. Nucleic Acids Res. 37: 4812-4825.
    Pubmed KoreaMed CrossRef
  39. Fillat MF. 2014. The FUR (ferric uptake regulator) superfamily: diversity and versatility of key transcriptional regulators. Arch. Biochem. Biophys. 546: 41-52.
    Pubmed CrossRef
  40. Seo SW, Kim D, Latif H, O'Brien EJ, Szubin R, Palsson BO. 2014. Deciphering Fur transcriptional regulatory network highlights its complex role beyond iron metabolism in Escherichia coli. Nat. Commun. 5: 4910.
    Pubmed KoreaMed CrossRef
  41. Johnson M, Sengupta M, Purves J, Tarrant E, Williams PH, Cockayne A, et al. 2011. Fur is required for the activation of virulence gene expression through the induction of the sae regulatory system in Staphylococcus aureus. Int. J. Med. Microbiol. 301: 44-52.
    Pubmed KoreaMed CrossRef
  42. Grunenwald CM, Choby JE, Juttukonda LJ, Beavers WN, Weiss A, Torres VJ, et al. 2019. Manganese detoxification by MntE is critical for resistance to oxidative stress and virulence of Staphylococcus aureus. MBio. 10. pii: e02915-18.
    Pubmed KoreaMed CrossRef
  43. Troxell B, Hassan HM. 2013. Transcriptional regulation by Ferric Uptake Regulator (Fur) in pathogenic bacteria. Front. Cell Infect.Microbiol. 3: 59.
    Pubmed KoreaMed CrossRef
  44. Massé E, Gottesman S. 2002. A small RNA regulates the expression of genes involved in iron metabolism in Escherichia coli. Proc. Natl. Acad. Sci. USA 99: 4620-4625.
    Pubmed KoreaMed CrossRef
  45. Pannekoek Y, Huis In't Veld R, Schipper K, Bovenkerk S, Kramer G, Speijer D, et al. 2017. Regulation of Neisseria meningitidis cytochrome bc1 components by NrrF, a Fur-controlled small noncoding RNA. FEBS Open Bio. 7: 1302-1315.
    Pubmed KoreaMed CrossRef
  46. Chen Z, Lewis KA, Shultzaberger RK, Lyakhov IG, Zheng M, Doan B, et al. 2007. Discovery of Fur binding site clusters in Escherichia coli by information theory models. Nucleic Acids Res. 35: 6762-6777.
    Pubmed KoreaMed CrossRef