전체메뉴
검색
Article Search

JMB Journal of Microbiolog and Biotechnology

QR Code QR Code

Note

References

  1. Visca P, Antunes LCS, Towner KJ. 2014. Acinetobacter baumannii: evolution of a global pathogen. Pathog. Dis. 71: 292-301.
    Pubmed CrossRef
  2. Beggs CB, Kerr KG, Snelling AM, Sleigh PA. 2006. Acinetobacter spp. and the clinical environment. Indoor. Built. Environ. 15: 19-24.
    CrossRef
  3. Morgan DJ, Liang SY, Smith CL, Johnson JK, Harris AD, Furuno JP, et al. 2010. Frequent multidrug-resistant Acinetobacter baumannii contamination of gloves, gowns, and hands of healthcare workers. Infect. Control Hosp. Epidemiol. 31: 716-721.
    Pubmed PMC CrossRef
  4. Lambiase A, Piazza O, Rossano F, Del Pezzo M, Tufano R, Catania MR. 2012. Persistence of carbapenem-resistant Acinetobacter baumannii strains in an Italian intensive care unit during a forty-six month study period. New Microbiol. 35: 199-206.
    Pubmed
  5. Maraki S, Mantadakis E, Mavromanolaki VE, Kofteridis DP, Samonis G. 2016. A 5-year surveillance study on antimicrobial resistance of Acinetobacter baumannii clinical isolates from a tertiary Greek hospital. Infect. Chemother. 48: 190-198.
    Pubmed PMC CrossRef
  6. Vocat A, Hartkoorn RC, Lechartier B, Zhang M, Dhar N, Cole ST, et al. 2015. Bioluminescence for assessing drug potency against nonreplicating Mycobacterium tuberculosis. Antimicrob. Agents Chemother. 59: 4012-4019.
    Pubmed PMC CrossRef
  7. Hakkila K, Maksimow M, Karp M, Virta M. 2002. Reporter genes lucFF, luxCDABE, gfp, and dsred have different characteristics in whole-cell bacterial sensors. Anal. Biochem. 301: 235-242.
    Pubmed CrossRef
  8. Brodl E, Winkler A, Macheroux P. 2018. Molecular mechanisms of bacterial bioluminescence. Comput. Struct. Biotechnol. J. 16: 551-564.
    Pubmed PMC CrossRef
  9. Choi KH, Gaynor JB, White KG, Lopez C, Bosio CM, Karkhoff-Schweizer RR, et al. 2005. A Tn7-based broadrange bacterial cloning and expression system. Nat. Methods. 2: 443-448.
    Pubmed CrossRef
  10. Choi K-H, Schweizer HP. 2006. Mini-Tn7 insertion in bacteria with single attTn7 sites: example Pseudomonas aeruginosa. Nat. Protoc. 1: 153.
    Pubmed CrossRef
  11. Mitra R, McKenzie GJ, Yi L, Lee CA, Craig NL. 2010. Characterization of the TnsD-attTn7 complex that promotes site-specific insertion of Tn7. Mob. DNA. 1: 18-18.
    Pubmed PMC CrossRef
  12. Damron FH, McKenney ES, Barbier M, Liechti GW, Schweizer HP, Goldberg JB. 2013. Construction of mobilizable mini-Tn7 vectors for bioluminescent detection of gram-negative bacteria and single-copy promoter lux reporter analysis. Appl. Environ. Microbiol. 79: 4149-4153.
    Pubmed PMC CrossRef
  13. Ducas-Mowchun K, De Silva PM, Crisostomo L, Fernando DM, Chao T-C, Pelka P, et al. 2019. Next generation of Tn7based single-copy insertion elements for use in multi- and pan-drug-resistant strains of Acinetobacter baumannii. Appl. Environ. Microbiol. 85: e00066-00019.
    Pubmed PMC CrossRef
  14. Bloor AE, Cranenburgh RM. 2006. A n ef ficient m ethod of selectable marker gene excision by Xer recombination for gene replacement in bacterial chromosomes. Appl. Environ. Microbiol. 72: 2520.
    Pubmed PMC CrossRef
  15. Cascioferro A, Boldrin F, Serafini A, Provvedi R, Palù G, Manganelli R. 2010. Xer site-specific recombination, an efficient tool to introduce unmarked deletions into mycobacteria. Appl. Environ. Microbiol. 76: 5312-5316.
    Pubmed PMC CrossRef
  16. Kono N, Arakawa K, Tomita M. 2011. Comprehensive prediction of chromosome dimer resolution sites in bacterial genomes. BMC Genomics 12: 19-19.
    Pubmed PMC CrossRef
  17. Yildirim S, Thompson MG, Jacobs AC, Zurawski DV, Kirkup B C. 2016. E valuation of parameters for high efficiency transformation of Acinetobacter baumannii. Sci Rep. 6: 22110.
    Pubmed PMC CrossRef
  18. Yang F, Tan Y, Liu J, Liu T, Wang B, Cao Y, et al. 2014. Efficient construction of unmarked recombinant mycobacteria using an improved system. J. Microbiol. Methods. 103: 29-36.
    Pubmed CrossRef
  19. Yang F, Njire MM, Liu J, Wu T, Wang B, Liu T, et al. 2015. Engineering more stable, selectable marker-Free autoluminescent mycobacteria by one step. PLoS One 10: e0119341.
    Pubmed PMC CrossRef
  20. Zhang T, Bishai WR, Grosset JH, Nuermberger EL. 2010. Rapid assessment of antibacterial activity against Mycobacterium ulcerans by using recombinant luminescent strains. Antimicrob. Agents Chemother. 54: 2806-2813.
    Pubmed PMC CrossRef
  21. Clinical and Laboratory Standards Institute. 2017. Performance Standards for Antimicrobial Susceptibility Testing, M100-27, 27th Ed. Clinical and Laboratory Standards Institute, Wayne, PA.
  22. Zhang T, Li SY, Nuermberger EL. 2012. Autoluminescent Mycobacterium tuberculosis for rapid, real-time, non-invasive assessment of drug and vaccine efficacy. PLoS One 7: e29774.
    Pubmed PMC CrossRef

Related articles in JMB

More Related Articles

Article

Note

J. Microbiol. Biotechnol. 2019; 29(9): 1488-1493

Published online September 28, 2019 https://doi.org/10.4014/jmb.1905.05006

Copyright © The Korean Society for Microbiology and Biotechnology.

One-Step Engineering of a Stable, Selectable Marker-Free Autoluminescent Acinetobacter baumannii for Rapid Continuous Assessment of Drug Activity

Huofeng Jiang 1, 2, Yamin Gao 2, 3, Sheng Zeng 2, 3, Shuai Wang 2, 3, Zhizhong Cao 4, Yaoju Tan 4, Huancai Yin 5, Jianxiong Liu 4* and Tianyu Zhang 2, 3*

1School of Life Sciences, University of Science and Technology of China, Hefei, Anhui 230027, P.R. China., 2State Key Laboratory of Respiratory Disease, Guangzhou Institutes of Biomedicine and Health, Chinese Academy of Sciences, Guangzhou, Guangdong 510530, P.R. China., 3University of Chinese Academy of Sciences (UCAS), Beijing 100049, P.R. China, 4State Key Laboratory of Respiratory Disease, Department of Clinical Laboratory, Guangzhou Chest Hospital, Guangzhou 510095, P.R. China., 5CAS Key Laboratory of Bio-Medical Diagnostics, Suzhou Institute of Biomedical Engineering and Technology, Chinese Academy of Sciences, Suzhou, Jiangsu 215163, P.R. China.

Correspondence to:Jianxiong Liu    ljxer64@qq.com
Tianyu Zhang    zhang_tianyu@gibh.ac.cn

Received: May 7, 2019; Accepted: August 1, 2019

Abstract

The rising cases of multidrug-resistant Acinetobacter baumannii (Ab) and the lack of effective drugs call for quick attention. Here, based on a Tn7 transposon and Xer/dif system, we constructed a stable, selectable marker-free autoluminescent Ab capable of producing visible light without extra substrates. Utilization of this autoluminescent reporter strain has the potential to reduce the time, effort and costs required for the evaluation of activities of anti-Ab drug candidates in vitro.

Keywords: Autoluminescent, marker-free, Acinetobacter baumannii, Tn7, Xer/dif recombination system

Body

Acinetobacter baumannii (Ab) is an important gram-negative bacteria causing opportunistic infections [1]. It is ubiquitous and one of the common causes of nosocomial infections [2-4]. The increasing infections caused by this microorganism and the emergence of multidrug-resistant (MDR) Ab strains pose a continuous threat to public health [5]. Considering the lack of effective drugs, there is an urgent need to develop new tools for rapid and efficient screening and evaluation of new drug candidates. Bioluminescence-based approaches such as using the luxCDABE operon as a reporter have been applied for the evaluation of antimicrobial drugs with significant benefits over conventional methods, e.g. solid agar method and liquid broth dilution method with turbidity values as the end points [6]. LuxAB catalyze the luminescence reaction involving the oxidation of reduced flavin mononucleotides and a long-chain fatty aldehyde substrate concomitant with the emission of blue-green light at 490 nm [7]. The luxCDE genes encode the fatty acid reductase complex required for the synthesis of the aldehyde substrate and thus contribute to the recycling of aldehyde [8]. Tn7 transposon inserts, at a relatively high frequency, into a specific site named attTn7 which was shown to be located downstream of glmS [9, 10]. More importantly, it is worth noting that the Tn7 insertion has no impact either on the expression of genes or on the growth of bacteria [11]. As such, the Tn7 transposon is a valuable and convenient tool for site-specific tagging in bacteria. Here, the previously described backbone vector pUC18T-mini-Tn7T-lux-Tp (Fig. S1A) containing both the luxCDABE operon and Tn7 [12] was utilized. Although this vector harbors a Flp recombinase target (FRT) cassette which can be used to obtain marker-free Tn7 insertions upon introduction of a Flp recombinase [13], the inconvenience of introduction and subsequent removal of the Flp recombinase renders the Flp/FRT system less appropriate. Instead, we utilized the Xer site-specific recombination system in which the removal of resistance genes is dependent on dif sequences and the endogenous Xer proteins only [14, 15]. Thus, based on the Tn7 transposon and Xer/dif system, we constructed a selectable marker-free autoluminescent Ab (UAlAb) expressing the native luxCDABE operon for rapid screening and evaluation of potential anti-Ab agents by continuously monitoring the light strength as the dead UAlAb can not give out light.

The autoluminescent Ab was engineered using one Ab clinical isolate that was confirmed by 16S rRNA gene sequencing using primers P27F and P1492R detailed in Table 1 (the sequence obtained shared approximately 99.79%identity relative to the reference Ab sequence: Accession No. MG234437.1). Importantly, the clinical strain displays a MDR phenotype (Table S1).

Table 1 . Primers used in this study#..

PrimersNucleotide sequence (5’-3’)
P27FAGAGTTTGATCCTGGCTCA
P1492RGGTTACCTTGTTACGACTT
PAb-dif-Apr-FCGGGATCCATGGTGTTCGTATAATGTATATTATGTTAAAT
CACCACCGACTATTTG
PAb-dif-Apr-RTGCTCTAGAAGCTTATTTAACATAATATACATTATACGAACA
AGCTCAGCCAATCGAC
PglmSF1TATGGAAGAAGTTCAGGCTC
PTn7RCACAGCATAACTGGACTGATTTC

#The dif sequences and restriction sites are underlined and in italic, respectively..



Based on the pUC18T-mini-Tn7T-lux-Tp, we first constructed a recombinant plasmid named pUC18T-mini-Tn7T-lux-Ab-dif-apr. This plasmid contained apramycin (APR)-resistance gene, apr, flanked by dif sequences as shown in Figs. S1B and S2. To amplify the apr gene, polymerase chain reaction (PCR) was performed using primers PAb-dif-Apr-F and PAb-dif-Apr-R, designed to include the previously described dif sequences [16] and restriction sites (Table 1), with the plasmid pMABH1 (Fig. S1C) as template. Notably, since the difference of the four types of dif sequences predicted in Ab [16] was rather small, by taking into account that each dif candidate may work and the only difference may be that they have different DNA dissociation efficiency, we tested only the sequence “TGTTCGTATAAT GTATATTATGTTAAAT” with the highest score as the dif sequence in our experiment (Table 1). The amplicon was thereafter digested and inserted into pUC18T-mini-Tn7T-lux-Tp between XbaI and BamHI sites, giving rise to the pUC18T-mini-Tn7T-lux-Ab-dif-apr (Fig. S1B). After verification by sequencing (BGI, Shenzhen, China), this plasmid was co-electroporated with a helper plasmid pTNS3 (Table S2) into Ab competent cells freshly prepared as described earlier [17], followed by selection on LB solid media with 100 µgml-1 APR. The resulting colonies were subject to detection of the relative light units (RLU) and PCR analysis using primers PglmSF1 and PTn7R (Table 1) to identify the insertion site. We considered clones yielding an RLU value of ≥105 and a PCR product of 368 bp as autoluminescent Abs (AlAb) [13] (Figs. 1A and 1B). All the plasmids and bacterial strains used in this study are listed in Table S2.

Figure 1. Confirmation of pUC18T-mini-Tn7T-lux-Ab-dif-apr genomic insertion in the Ab strain and the loss of apr by PCR. (A) Localization of primers for PCR analysis in Fig. 1B. (B) Verification of the pUC18T-mini-Tn7T-lux-Ab-dif-apr genomic insertion into the Ab strain. Positive clones yielded an amplicon of 368 bp. Lane M, trans 2K plus DNA Marker (Transgene); lane 1, DNA of Ab containing pUC18Tmini- Tn7T-lux-Ab-dif-apr as the template; lane 2, DNA of the parental Ab as the template; (C) The primer pair PAb-dif-Apr-F and PAb-dif-Apr-R was used to verify the loss of apr. Lane M, trans 2K plus DNA Marker; lane 1, positive control for apr; lane 2, lack of band indicating successful removal of apr in UAlAb.

Since the resistance gene may cause cross resistance to potential active compounds in drug screening, we next removed the apr gene, as described previously [18], to engineer the marker-free autoluminescent Ab (UAlAb)(Fig. S2). Briefly, the AlAb strain was subcultured in APR-free LB medium to late log phase to allow excision of the apr gene by endogenous XerC and XerD [19], followed by serial dilution and plating on APR-free LB agar plates. Individual colonies were picked, re-subcultured and plated on APR-free LB agar plates for a total of 5 rounds. To calculate removal efficiency (RE) of the apr gene, fifty single colonies from each round were randomly picked and replica streaked on both APR-free and APR-containing (100 µg ml-1) LB plates. Colonies that could only grow on APR-free but not on APR-containing LB plates were UAlAbs. The loss of apr in UAlAbs was further confirmed by PCR using primers PAb-dif-Apr-F and PAb-dif-Apr-R (Fig. 1C). The RE was calculated as per the formula shown below:

RE =Number of colonies on plain media Number of colonies on APR containing mediaNumber of colonies picked (50)× 100%.

We observed that the RE values gradually elevated with the increase of the rounds (Table S3), indicating that the dif-apr-dif sequence (Fig. S1B) was recognized and cleaved during the incubation in the absence of APR. To assess whether the obtained UAlAb could produce strong light stably, we grew the UAlAb cells for 30-35 generations, after which the culture was serially diluted and plated on APRfree LB agar plates. We randomly picked 200 colonies for RLU detection and observed that the percentage of autoluminescent clones, judged by RLU values of ≥ 105, was 100%. Therefore, the UAlAb that we obtained is a stable reporter strain.

To assess whether the inserted element interfered with bacterial growth, we compared growth between UAlAb and its parental strain. As shown in Fig. 2, the growth of UAlAb, judged by both OD600 (Fig. 2A) and CFUs (Fig. 2B), is comparable to that of its parental strain, suggesting that the inserted DNA element did not influence the growth of the bacteria under the tested condition. We also monitored RLU levels over the incubation period. It was observed that the RLU curve of the UAlAb culture fitted well with its CFU curve (Fig. 2B). Therefore, RLU can be used as an indicator of bacterial growth in UAlAb.

Figure 2. Growth curves of Ab and UAlAb. (A) Growth curves of UAlAb and Ab by OD600. (B) Growth curves by CFUs and RLUs of UAlAb. (C) MIC determination by real-time RLU measurement using UAlAb. Drug concentrations (μg ml-1). Means ± standard deviation (SD) of data from three repeated experiments are shown.

To test whether the UAlAb could be used for drug susceptibility assay, we first assessed the effect of the DNA element insertion on Ab’s drug susceptibility using various antibiotics with distinct mechanisms of action (i.e. tigecycline, levofloxacin, APR and polymyxin B). Briefly, 500 µl of serial dilutions of Ab and UAlAb cultures were separately plated onto LB plates containing serial concentrations of drugs. As shown in Table 2, the MICs of the tested drugs, determined by solid agar method [20], were identical between UAlAb and Ab strains, suggesting that the general antibiotic susceptibility is not altered in UAlAb strain. Therefore, we next determined the MICs using Mueller Hinton (MH) media by either RLUs for the UAlAb strain or standard liquid broth method [21] for the parental strain. MICs determined by RLUs were performed as follows. One hundred µl of each drug dilution was added to a 1.5 ml micro-centrifuge tube containing 100 µl UAlAb, followed by RLU measurement for 4 times using the GloMax 20/20 Luminometer (Promega) at a 2-h interval. The MICs of the tested drugs determined by RLU were comparable to those by the conventional broth method (Table 2). Furthermore, the MICs against the UAlAb strain, measured by either RLUs or by standard broth assay, were also identical. Together, these results demonstrate that RLU measurement using the UAlAb strain as an alternative methodology for antibiotic susceptibility testing is both feasible and valid. Given that autoluminescence can offer additional advantages, such as real-time detection and quicker kinetic monitoring of drug activities [22], we performed real-time RLU measurement for the UAlAb culture in the presence of varying concentrations of drugs. As shown in Fig. 2C, the MICs of the drugs (Table 2) could be obtained as early as 2 h post inoculation by monitoring RLU. Therefore, we propose that UAlAb can be used as a useful surrogate reporter strain in future screening and evaluation of new anti-Ab candidates.

Table 2 . MICs of tigecycline, levofloxacin, APR and polymyxin B for UAlAb and Ab..

DrugMIC (µg ml-1) solidaMIC (µg ml-1) liquid

UAlAbAbUAlAbbAbc
Tigecycline32324-84-8
Levofloxacin646416-32d16-32d
APR32323232

Polymyxin B440.250.25

The results are based on three independent experiments..

aThe MIC was defined as the lowest drug concentration inhibiting at least 99% of bacterial growth observed for drug-free control plates..

bThe MIC was determined by RLU measurement in Mueller Hinton (MH) media and defined as the lowest drug concentration that decreased ≥ 90% RLU relative to that of the drug-free control..

cThe MIC was determined in MH media defined as the lowest drug concentration inhibiting visible growth after 18 h of incubation at 37°C..

dThe MICs obtained were 16 or 32 μg ml-1 based on repeated experiments..



In conclusion, based on a Tn7 transposon and Xer/dif system, we successfully constructed a stable, selectable marker-free autoluminescent Ab strain by one step that could be valuable for drug susceptibility assay in vitro.

Supplemental Materials

Acknowledgments

This work was supported by the National Mega-project of China for Innovative Drugs (2019ZX09721001-003-003), by the Chinese Academy of Sciences Grant (YJKYYQ20170036), by the Public Research and Capacity Building Project of Guangdong Province (2017A020212004) and by the Grant (SKLRD-OP-201919) from the State Key Lab of Respiratory Disease, Guangzhou Institute of Respiratory Diseases, First Affiliated Hospital of Guangzhou Medical University. T.Z. received Science and Technology Innovation Leader of Guangdong Province (2016TX03R095). The founders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. We thank Professor Joanna B. Goldberg for generously providing the plasmids pUC18T-mini-Tn7T-lux-Tp and pTNS3.

Conflict of Interest

The authors have no financial conflicts of interest to declare.

Transparency Declarations

The selectable marker-free autoluminescent Acinetobacter baumannii and the techniques used for its construction were filed for a China invention patent in Jan 2019 (Application number: 201910051035.0).

Fig 1.

Figure 1.Confirmation of pUC18T-mini-Tn7T-lux-Ab-dif-apr genomic insertion in the Ab strain and the loss of apr by PCR. (A) Localization of primers for PCR analysis in Fig. 1B. (B) Verification of the pUC18T-mini-Tn7T-lux-Ab-dif-apr genomic insertion into the Ab strain. Positive clones yielded an amplicon of 368 bp. Lane M, trans 2K plus DNA Marker (Transgene); lane 1, DNA of Ab containing pUC18Tmini- Tn7T-lux-Ab-dif-apr as the template; lane 2, DNA of the parental Ab as the template; (C) The primer pair PAb-dif-Apr-F and PAb-dif-Apr-R was used to verify the loss of apr. Lane M, trans 2K plus DNA Marker; lane 1, positive control for apr; lane 2, lack of band indicating successful removal of apr in UAlAb.
Journal of Microbiology and Biotechnology 2019; 29: 1488-1493https://doi.org/10.4014/jmb.1905.05006

Fig 2.

Figure 2.Growth curves of Ab and UAlAb. (A) Growth curves of UAlAb and Ab by OD600. (B) Growth curves by CFUs and RLUs of UAlAb. (C) MIC determination by real-time RLU measurement using UAlAb. Drug concentrations (μg ml-1). Means ± standard deviation (SD) of data from three repeated experiments are shown.
Journal of Microbiology and Biotechnology 2019; 29: 1488-1493https://doi.org/10.4014/jmb.1905.05006

Table 1 . Primers used in this study#..

PrimersNucleotide sequence (5’-3’)
P27FAGAGTTTGATCCTGGCTCA
P1492RGGTTACCTTGTTACGACTT
PAb-dif-Apr-FCGGGATCCATGGTGTTCGTATAATGTATATTATGTTAAAT
CACCACCGACTATTTG
PAb-dif-Apr-RTGCTCTAGAAGCTTATTTAACATAATATACATTATACGAACA
AGCTCAGCCAATCGAC
PglmSF1TATGGAAGAAGTTCAGGCTC
PTn7RCACAGCATAACTGGACTGATTTC

#The dif sequences and restriction sites are underlined and in italic, respectively..


Table 2 . MICs of tigecycline, levofloxacin, APR and polymyxin B for UAlAb and Ab..

DrugMIC (µg ml-1) solidaMIC (µg ml-1) liquid

UAlAbAbUAlAbbAbc
Tigecycline32324-84-8
Levofloxacin646416-32d16-32d
APR32323232

Polymyxin B440.250.25

The results are based on three independent experiments..

aThe MIC was defined as the lowest drug concentration inhibiting at least 99% of bacterial growth observed for drug-free control plates..

bThe MIC was determined by RLU measurement in Mueller Hinton (MH) media and defined as the lowest drug concentration that decreased ≥ 90% RLU relative to that of the drug-free control..

cThe MIC was determined in MH media defined as the lowest drug concentration inhibiting visible growth after 18 h of incubation at 37°C..

dThe MICs obtained were 16 or 32 μg ml-1 based on repeated experiments..


References

  1. Visca P, Antunes LCS, Towner KJ. 2014. Acinetobacter baumannii: evolution of a global pathogen. Pathog. Dis. 71: 292-301.
    Pubmed CrossRef
  2. Beggs CB, Kerr KG, Snelling AM, Sleigh PA. 2006. Acinetobacter spp. and the clinical environment. Indoor. Built. Environ. 15: 19-24.
    CrossRef
  3. Morgan DJ, Liang SY, Smith CL, Johnson JK, Harris AD, Furuno JP, et al. 2010. Frequent multidrug-resistant Acinetobacter baumannii contamination of gloves, gowns, and hands of healthcare workers. Infect. Control Hosp. Epidemiol. 31: 716-721.
    Pubmed KoreaMed CrossRef
  4. Lambiase A, Piazza O, Rossano F, Del Pezzo M, Tufano R, Catania MR. 2012. Persistence of carbapenem-resistant Acinetobacter baumannii strains in an Italian intensive care unit during a forty-six month study period. New Microbiol. 35: 199-206.
    Pubmed
  5. Maraki S, Mantadakis E, Mavromanolaki VE, Kofteridis DP, Samonis G. 2016. A 5-year surveillance study on antimicrobial resistance of Acinetobacter baumannii clinical isolates from a tertiary Greek hospital. Infect. Chemother. 48: 190-198.
    Pubmed KoreaMed CrossRef
  6. Vocat A, Hartkoorn RC, Lechartier B, Zhang M, Dhar N, Cole ST, et al. 2015. Bioluminescence for assessing drug potency against nonreplicating Mycobacterium tuberculosis. Antimicrob. Agents Chemother. 59: 4012-4019.
    Pubmed KoreaMed CrossRef
  7. Hakkila K, Maksimow M, Karp M, Virta M. 2002. Reporter genes lucFF, luxCDABE, gfp, and dsred have different characteristics in whole-cell bacterial sensors. Anal. Biochem. 301: 235-242.
    Pubmed CrossRef
  8. Brodl E, Winkler A, Macheroux P. 2018. Molecular mechanisms of bacterial bioluminescence. Comput. Struct. Biotechnol. J. 16: 551-564.
    Pubmed KoreaMed CrossRef
  9. Choi KH, Gaynor JB, White KG, Lopez C, Bosio CM, Karkhoff-Schweizer RR, et al. 2005. A Tn7-based broadrange bacterial cloning and expression system. Nat. Methods. 2: 443-448.
    Pubmed CrossRef
  10. Choi K-H, Schweizer HP. 2006. Mini-Tn7 insertion in bacteria with single attTn7 sites: example Pseudomonas aeruginosa. Nat. Protoc. 1: 153.
    Pubmed CrossRef
  11. Mitra R, McKenzie GJ, Yi L, Lee CA, Craig NL. 2010. Characterization of the TnsD-attTn7 complex that promotes site-specific insertion of Tn7. Mob. DNA. 1: 18-18.
    Pubmed KoreaMed CrossRef
  12. Damron FH, McKenney ES, Barbier M, Liechti GW, Schweizer HP, Goldberg JB. 2013. Construction of mobilizable mini-Tn7 vectors for bioluminescent detection of gram-negative bacteria and single-copy promoter lux reporter analysis. Appl. Environ. Microbiol. 79: 4149-4153.
    Pubmed KoreaMed CrossRef
  13. Ducas-Mowchun K, De Silva PM, Crisostomo L, Fernando DM, Chao T-C, Pelka P, et al. 2019. Next generation of Tn7based single-copy insertion elements for use in multi- and pan-drug-resistant strains of Acinetobacter baumannii. Appl. Environ. Microbiol. 85: e00066-00019.
    Pubmed KoreaMed CrossRef
  14. Bloor AE, Cranenburgh RM. 2006. A n ef ficient m ethod of selectable marker gene excision by Xer recombination for gene replacement in bacterial chromosomes. Appl. Environ. Microbiol. 72: 2520.
    Pubmed KoreaMed CrossRef
  15. Cascioferro A, Boldrin F, Serafini A, Provvedi R, Palù G, Manganelli R. 2010. Xer site-specific recombination, an efficient tool to introduce unmarked deletions into mycobacteria. Appl. Environ. Microbiol. 76: 5312-5316.
    Pubmed KoreaMed CrossRef
  16. Kono N, Arakawa K, Tomita M. 2011. Comprehensive prediction of chromosome dimer resolution sites in bacterial genomes. BMC Genomics 12: 19-19.
    Pubmed KoreaMed CrossRef
  17. Yildirim S, Thompson MG, Jacobs AC, Zurawski DV, Kirkup B C. 2016. E valuation of parameters for high efficiency transformation of Acinetobacter baumannii. Sci Rep. 6: 22110.
    Pubmed KoreaMed CrossRef
  18. Yang F, Tan Y, Liu J, Liu T, Wang B, Cao Y, et al. 2014. Efficient construction of unmarked recombinant mycobacteria using an improved system. J. Microbiol. Methods. 103: 29-36.
    Pubmed CrossRef
  19. Yang F, Njire MM, Liu J, Wu T, Wang B, Liu T, et al. 2015. Engineering more stable, selectable marker-Free autoluminescent mycobacteria by one step. PLoS One 10: e0119341.
    Pubmed KoreaMed CrossRef
  20. Zhang T, Bishai WR, Grosset JH, Nuermberger EL. 2010. Rapid assessment of antibacterial activity against Mycobacterium ulcerans by using recombinant luminescent strains. Antimicrob. Agents Chemother. 54: 2806-2813.
    Pubmed KoreaMed CrossRef
  21. Clinical and Laboratory Standards Institute. 2017. Performance Standards for Antimicrobial Susceptibility Testing, M100-27, 27th Ed. Clinical and Laboratory Standards Institute, Wayne, PA.
  22. Zhang T, Li SY, Nuermberger EL. 2012. Autoluminescent Mycobacterium tuberculosis for rapid, real-time, non-invasive assessment of drug and vaccine efficacy. PLoS One 7: e29774.
    Pubmed KoreaMed CrossRef