전체메뉴
검색
Article Search

JMB Journal of Microbiolog and Biotechnology

QR Code QR Code

Research article

References

  1. Walls J, Sinclair L, Finlay D. 2016. Nutrient sensing, signal transduction and immune responses. Semin. Immunol. 28: 396-407.
    Pubmed CrossRef
  2. Miccadei S, Masella R, Mileo AM, Gessani S. 2016. Omega3 polyunsaturated fatty acids as immunomodulators in colorectal cancer: new potential role in adjuvant therapies. Front. Immunol. 7: 486.
    CrossRef
  3. Roche HM. 1999. Unsaturated fatty acids. Proc. Nutr. Soc. 58: 397-401.
    Pubmed CrossRef
  4. Ford JH. 2010. Saturated fatty acid metabolism is key link between cell division, cancer, and senescence in cellular and whole organism aging. Age (Dordr.) 32: 231-237.
    Pubmed PMC CrossRef
  5. Volpe JJ, Vagelos PR. 1976. Mechanisms and regulation of biosynthesis of saturated fatty acids. Physiol. Rev. 56: 339-417.
    Pubmed CrossRef
  6. Zock PL, Blom WA, Nettleton JA, Hornstra G. 2016. Progressing insights into the role of dietary fats in the prevention of cardiovascular disease. Curr. Cardiol. Rep. 18: 111.
    Pubmed PMC CrossRef
  7. Fasano E, Serini S, Cittadini A, Calviello G. 2015. Longchain n-3 PUFA against breast and prostate cancer: which are the appropriate doses for intervention studies in animals and humans? Crit. Rev. Food Sci. Nutr. 57: 2245-2262.
    Pubmed CrossRef
  8. Zheng JS, Huang T, Yang J, Fu YQ, Li D. 2012. Marine N-3 polyunsaturated fatty acids are inversely associated with risk of type 2 diabetes in Asians: a systematic review and meta-analysis. PLoS One 7: e44525.
    Pubmed PMC CrossRef
  9. Massey KA, Nicolaou A. 2011. Lipidomics of polyunsaturatedfatty-acid-derived oxygenated metabolites. Biochem. Soc. Trans. 39: 1240-1246.
    Pubmed CrossRef
  10. Nicolaou A. 2013. Eicosanoids in skin inflammation. Prostaglandins Leukot. Essent. Fatty Acids 88: 131-138.
    Pubmed CrossRef
  11. Wolfe LS. 1982. Eicosanoids: prostaglandins, thromboxanes, leukotrienes, and other derivatives of carbon-20 unsaturated fatty acids. J. Neurochem. 38: 1-14.
    Pubmed CrossRef
  12. Calder PC. 2013. Omega-3 polyunsaturated fatty acids and inflammatory processes: nutrition or pharmacology? Br. J. Clin. Pharmacol. 75: 645-662.
    Pubmed PMC CrossRef
  13. Davidson J, Rotondo D, Rizzo MT, Leaver HA. 2012. Therapeutic implications of disorders of cell death signalling: membranes, micro-environment, and eicosanoid and docosanoid metabolism. Br. J. Pharmacol. 166: 1193-1210.
    Pubmed PMC CrossRef
  14. Greene ER, Huang S, Serhan CN, Panigrahy D. 2011. Regulation of inflammation in cancer by eicosanoids. Prostaglandins Other Lipid Mediat. 96: 27-36.
    Pubmed PMC CrossRef
  15. Shah AK, Kinoshita M, Kurihara H, Ohnishi M, Takahashi K. 2008. Glycosylceramides obtain from the starfish Asterias amurensis Lütken. J. Oleo Sci. 57: 477-484.
    Pubmed CrossRef
  16. Dong G, Xu T, Yang B, Lin X, Zhou X, Yang X, et al. 201 1. Chemical constituents and bioactivities of starfish. Chem. Biodivers. 8: 740-791.
    Pubmed CrossRef
  17. D'Orazio N, Gammone MA, Gemello E, De Girolamo M, Cusenza S, Riccioni G. 2012. Marine bioactives: pharmacological properties and potential applications against inflammatory diseases. Mar. Drugs 10: 812-833.
    Pubmed PMC CrossRef
  18. Mayer AM, Hamann MT. 2005. Marine pharmacology in 2001-2002: marine compounds with anthelmintic, antibacterial, anticoagulant, antidiabetic, antifungal, anti-inflammatory, antimalarial, antiplatelet, antiprotozoal, antituberculosis, and antiviral activities; affecting the cardiovascular, immune and nervous systems and other miscellaneous mechanisms of action. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 140: 265-286.
    Pubmed PMC CrossRef
  19. Higuchi R, Inoue S, Inagaki K, Sakai M, Miyamoto T, Komori T, et al. 2006. Biologically active glycosides from asteroidea, 42. Isolation and structure of a new biologically active ganglioside molecular species from the starfish Asterina pectinifera. Chem. Pharm. Bull. (Tokyo) 54: 287-291.
    Pubmed CrossRef
  20. Han YH, Ham JH, Lee NJ, Park CH, Shin YH, Lee DU. 2000. Antimutagenic activity of 5alpha-cholest-7-en-3beta-ol, a new component from the starfish Asterina pectinifera. Biol. Pharm. Bull. 23: 1247-1249.
    Pubmed CrossRef
  21. Peng Y, Zheng J, Huang R, Wang Y, Xu T, Zhou X, et al. 2010. Polyhydroxy steroids and saponins from China Sea starfish Asterina pectinifera and their biological activities. Chem. Pharm. Bull. (Tokyo) 58: 856-858.
    Pubmed CrossRef
  22. Hossain Z, Kurihara H, Hosokawa M, Takahashi K. 2006. Docosahexaenoic acid and eicosapentaenoic acid-enriched phosphatidylcholine liposomes enhance the permeability, transportation and uptake of phospholipids in Caco-2 cells. Mol. Cell. Biochem. 285: 155-163.
    Pubmed CrossRef
  23. Li G, Sinclair AJ, Li D. 2011. Comparison of lipid content and fatty acid composition in the edible meat of wild and cultured freshwater and marine fish and shrimps from China. J. Agric. Food Chem. 59: 1871-1881.
    Pubmed CrossRef
  24. Koftayan T, Milano J, D'Armas H, Salazar G. 2011. Lipid and fatty acid profile of Perna viridis, green mussel (Mollusca: Bivalvia) in different areas of the Eastern Venezuela and the West Coast of Trinidad. Rev. Biol. Trop. 59: 171-182.
    Pubmed CrossRef
  25. Garces R, Mancha M. 1993. One-step lipid extraction and fatty acid methyl esters preparation from fresh plant tissues. Anal. Biochem. 211: 139-143.
    Pubmed CrossRef
  26. Park WJ, Kothapalli KS, Lawrence P, Tyburczy C, Brenna JT. 2009. An alternate pathway to long-chain polyunsaturates: the FADS2 gene product delta8-desaturates 20:2n-6 and 20:3n-3. J. Lipid Res. 50: 1195-1202.
    Pubmed PMC CrossRef
  27. Cao RA, Lee Y, You S. 2014. Water soluble sulfated-fucans with immune-enhancing properties from Ecklonia cava. Int. J. Biol. Macromol. 67: 303-311.
    Pubmed CrossRef
  28. Green LC, Wagner DA, Glogowski J, Skipper PL, Wishnok JS, Tannenbaum SR. 1982. Analysis of nitrate, nitrite, and [15N]nitrate in biological fluids. Anal. Biochem. 126: 131-138.
    Pubmed CrossRef
  29. Narayanan BA, Narayanan NK, Simi B, Reddy BS. 2003. Modulation of inducible nitric oxide synthase and related proinflammatory genes by the omega-3 fatty acid docosahexaenoic acid in human colon cancer cells. Cancer Res. 63: 972-979.
    Pubmed
  30. Kang S, Min H. 2012. Ginseng, the 'immunity boost': the effects of Panax ginseng on immune system. J. Ginseng Res. 36: 354-368.
    Pubmed PMC CrossRef
  31. Lechner M, Lirk P, Rieder J. 2005. Inducible nitric oxide synthase (iNOS) in tumor biology: the two sides of the same coin. Semin. Cancer Biol. 15: 277-289.
    Pubmed CrossRef
  32. Surayot U, Wang J, Lee JH, Kanongnuch C, Peerapornpisal Y, You S. 2015. Characterization and immunomodulatory activities of polysaccharides from Spirogyra neglecta (Hassall) Kutzing. Biosci. Biotechnol. Biochem. 79: 1644-1653.
    CrossRef
  33. Olefsky JM, Glass CK. 2010. Macrophages, inflammation, and insulin resistance. Annu. Rev. Physiol. 72: 219-246.
    Pubmed CrossRef
  34. Hu SS, Bradshaw HB, Chen JS, Tan B, Walker JM. 2008. Prostaglandin E2 glycerol ester, an endogenous COX-2 metabolite of 2-arachidonoylglycerol, induces hyperalgesia and modulates NFkappaB activity. Br. J. Pharmacol. 153: 1538-1549.
    Pubmed PMC CrossRef
  35. Zhao Y, Liu J, Liu C, Zeng X, Li X, Zhao J. 2016. Anti-inflammatory effects of p-coumaric acid in LPS-stimulated RAW264.7 cells: involvement of NF-κB and MAPKs pathways. Med. Chem. 6: 327-330.
    CrossRef
  36. Baeuerle PA, Baltimore D. 1996. NF-kappa B: ten years after. Cell 87: 13-20.
    Pubmed CrossRef
  37. Kim JB, Han AR, Park EY, Kim JY, Cho W, Lee J, et al. 2007. Inhibition of LPS-induced iNOS, COX-2 and cytokines expression by poncirin through the NF-kappaB inactivation in RAW 264.7 macrophage cells. Biol. Pharm. Bull. 30: 2345-2351.
    Pubmed CrossRef
  38. Cargnello M, Roux PP. 2011. Activation and function of the MAPKs and their substrates, the MAPK-activated protein kinases. Microbiol. Mol. Biol. Rev. 75: 50-83.
    Pubmed PMC CrossRef
  39. Li YY, Hsieh LL, Tang RP, Liao SK, Yeh KY. 2009. Interleukin-6 (IL-6) released by macrophages induces IL-6 secretion in the human colon cancer HT-29 cell line. Hum. Immunol. 70: 151-158.
    Pubmed CrossRef
  40. Allam-Ndoul B, Guenard F, Barbier O, Vohl MC. 2016. Effect of n-3 fatty acids on the expression of inflammatory genes in THP-1 macrophages. Lipids Health Dis. 15: 69.
    Pubmed PMC CrossRef
  41. Yang SC, Sung PJ, Lin CF, Kuo J, Chen CY, Hwang TL. 2014. Anti-inflammatory effects of secondary metabolites of marine Pseudomonas sp. in human neutrophils are through inhibiting P38 MAPK, JNK, and calcium pathways. PLoS One 9: e114761.
    Pubmed PMC CrossRef

Related articles in JMB

More Related Articles

Article

Research article

J. Microbiol. Biotechnol. 2018; 28(3): 349-356

Published online March 28, 2018 https://doi.org/10.4014/jmb.1709.09005

Copyright © The Korean Society for Microbiology and Biotechnology.

Immune Enhancement Effect of Asterias amurensis Fatty Acids through NF-κB and MAPK Pathways on RAW 264.7 Cells

Chaiwat Monmai 1, Seok Hyeon Go 1, Il-shik Shin 1, SangGuan You 1, Hyungjae Lee 2, SeokBeom Kang 3 and Woo Jung Park 1*

1Department of Marine Food Science and Technology, Gangneung-Wonju National University, Gangneung 25457, Republic of Korea, 2Department of Food Engineering, Dankook University, Cheonan 31116, Republic of Korea, 3Citrus Research Station, National Institute of Horticultural & Herbal Science, RDA, Seogwipo 63607, Republic of Korea

Correspondence to:Woo Jung  Park
pwj0505@gwnu.ac.kr

Received: September 4, 2017; Accepted: November 29, 2017

Abstract

Asterias amurensis is a marine organism that causes damage to the fishing industry worldwide; however, it has been considered a promising source of functional components. The present study aimed to investigate the immune-enhancing effects of fatty acids from three organs of A. amurensis on murine macrophages (RAW 264.7 cells). A. amurensis fatty acids boosted production of immune-associated factors such as nitric oxide (NO) and prostaglandin E2 in RAW 264.7 cells. A. amurensis fatty acids also enhanced the expression of critical immuneassociated genes, including iNOS, TNF-α, IL-1β, and IL-6, as well as COX-2. Western blotting showed that A. amurensis fatty acids stimulated the NF-κB and MAPK pathways by phosphorylation of NF-κB p-65, p38, ERK1/2, and JNK. A. amurensis fatty acids from different tissues resulted in different levels of NF-κB and MAPK phosphorylation in RAW 264.7 cells. The results increase our understanding of how A. amurensis fatty acids boost immunity in a physiological system, as a potential functional material.

Keywords: Immune enhancement, fatty acid, NF-&kappa,B pathway, MAPK pathway, starfish

Introduction

Immune cells are provided with sufficient fuel to sustain energy homeostasis and cellular processes under normal homeostatic conditions [1]. Diet and its components are important in human health and are associated with the immune system, secretion of adipokines, and metabolic pathways [2]. Lipids containing fat-soluble vitamins and fatty acids are notable nutritional components for human health, and are important to prevent diseases associated with their compositional alteration [3]. In particular, free fatty acids have been reported to be associated with immune function and modulation [1]. Diverse fatty acids, including saturated fatty acids, monounsaturated fatty acids, and polyunsaturated fatty acids (PUFAs), are associated with chronic diseases such as cardiovascular disease, cancers, and diabetes [4-8].

Omega-6 PUFAs, including arachidonic acid (ARA, 20:4n-6), and omega-3 PUFAs, such as eicosapentaenoic acid (EPA, 20:5n-3) and docosahexaenoic acid (DHA, 22:6n-3), are associated with inflammation and the immune system. These fatty acids, which include more than 20 carbon atoms containing more than two double bonds, are the precursors of lipid signaling molecules, such as eicosanoids and docosanoids, catalyzed by cyclooxygenases (COX) and lipoxygenases [9, 10]. They are crucial cellular signaling factors related to inflammation and immune regulation in physiological systems [11]. ARA and EPA are precursors of pro-inflammatory and anti-inflammatory eicosanoids [11, 12]. DHA is a precursor of anti-inflammation-associated lipid signaling molecules known as docosanoids, such as resolvins and protectins [13], which are anti-lipid mediators for cancer therapy [14]. In addition, long-chain omega-3 PUFAs, EPA, and DHA were reported to provide beneficial effects in diseases such as arthritis and asthma via positive immune regulation [11, 12].

The starfish Asterias amurensis is an important harmful organism that causes damage to the fishing industry, and is found in the North Pacific Ocean as well as the east coast of Korea [15]. However, starfish, including A. amurensis, have also been considered a potential source of various bioactive natural products, including steroids, saponins, steroidal glycosides, anthraquinones, alkaloids, phospholipids, and peptides [16]. These compounds show antitumor, anti-inflammatory [17], immunomodulatory, anti-allergy, antifungal, hemolytic [18], antimutagenic [19], neuritogenic [20], cytotoxic, and antiviral [21] effects. In particular, A. amurensis possesses phosphatidylcholine that contains large amounts of EPA [22] and glycosylceramide [15]. The fatty acid profiles of A. amurensis and their anti-inflammatory regulation against murine macrophage cells have been confirmed. However, no study has reported the immune regulation in murine macrophages, such as RAW 264.7 cells, by fatty acids from A. amurensis. The present study shows that fatty acids from A. amurensis induce immunity-related cytokines and signaling proteins in RAW 264.7 cells.

Materials and Methods

Starfish Sample

To reduce the variation of starfish lipid content, A. amurensis samples were obtained from the Eastern Sea near Gangwon province, South Korea, in April 2015 [23, 24]. Three organs (skin, gonad, and the digestive gland (d-gland)) were identified and dissected to extract fatty acids.

Fatty Acid Preparation

Fatty acids were extracted according to a modified version of the one-step method described by Garces and Mancha [25]. Fatty acids were purified using a one-step hydrolysis and extraction method, as modified previously [26].

Nitric Oxide Production

Murine macrophages (RAW 264.7 cells; Korean Cell Line Bank, Korea) were incubated in RPMI-1640 medium (Gibco Laboratories, USA) supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin. The macrophages were cultured with different concentrations (0.5%, 1.0%, 1.5%, 2.0%, 2.5%, 3.0%, 3.5%, or 4.0%(v/v); volume of fatty acids / total culture volume of cells) of A. amurensis fatty acids or with 1 μg/ml of lipopolysaccharide (LPS; Sigma-Aldrich, USA) as a positive control. Nitric oxide (NO) in the macrophage culture supernatant induced by treatment with A. amurensis fatty acids was analyzed using the Griess reagent (Sigma-Aldrich) [27, 28] at an optical density of 540 nm.

Total RNA Preparation and Expression Analysis of Immune-Associated Genes

Total RNA was extracted from the macrophages, using the Tri reagent (Molecular Research Center, Inc., USA), and the nucleotide concentration was evaluated using a nanophotometer (Implen, Germany). Complementary DNA (cDNA) was prepared using a High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific, USA) according to the manufacturer’s instructions.

The transcription of five immune-associated genes (iNOS, COX-2, IL-1β, IL-6, and TNF-α) as well as β-actin (as a control) was analyzed using the QuantStudio 7 FlexReal-Time PCR System (Thermo Fisher Scientific, USA), in a 96-well format, in a total reaction volume of 20 μl/well, using SYBR Premix Ex Taq II (Takara Bio Inc., Japan). The specific primer pairs used are shown in Table 1.

Table 1 . Sequences of oligonucleotide primers used to amplify immune-associated genes..

Gene nameAccession No.Nucleotide SequenceProduct size (bp)
iNOSBC062378.1F: TTCCAGAATCCCTGGACAAG
R: TGGTCAAACTCTTGGGGTTC
180
IL-1 βNM_008361.4F: GGGCCTCAAAGGAAAGAATC
R: TACCAGTTGGGGAACTCTGC
183
IL-6NM_031168.2F: AGTTGCCTTCTTGGGACTGA
R: CAGAATTGCCATTGCACAAC
191
COX-2NM_011198.4F: AGAAGGAAATGGCTGCAGAA
R: GCTCGGCTTCCAGTATTGAG
194
TNF-αD84199.2F: ATGAGCACAGAAAGCATGATC
R: TACAGGCTTGTCACTCGAATT
276
β-ActinNM_007393.5F: CCACAGCTGAGAGGAAATC
R: AAGGAAGGCTGGAAAAGAGC
193


Western Blotting

RAW 264.7 cells were cultured with different concentrations (0.5%, 1.0%, 1.5%, or 2.0%) of A. amurensis fatty acids. After 24 h, protein samples were prepared using radioimmunoprecipitation assay buffer (Tech & Innovation, China) and the protein concentration was measured using a Pierce BCA Protein Assay Kit (Thermo Fisher Scientific, USA). Western blotting was performed using polyvinylidene difluoride membranes, according to the method of Narayanan et al. [29]. The membranes were incubated with specific antibodies recognizing p (phosphorylated)-NF-κB p65 (R&D Systems, USA), p-p38 (R&D Systems, USA), p-ERK1/2 (R&D Systems), p-JNK (R&D Systems), and β-actin (Santa Cruz Biotechnology, Inc., USA). After incubation with the appropriate secondary antibodies, the immunoreactive proteins were detected using the Pierce ECL Plus Western Blotting Substrate (Thermo Fisher Scientific).

Quantification of Prostaglandin E2 (PGE2)

PGE2 production was analyzed using a PGE2 enzyme-linked immunosorbent assay (ELISA) kit (Enzo Life Sciences, USA) according to the manufacturer’s instructions. PGE2 production was also analyzed using p-nitrophenyl phosphate as a substrate, at an absorbance of 405 nm. The experiment was carried out in duplicate, and PGE2 production was measured on the basis of a standard curve.

Statistical Analysis

The results were analyzed using Statistix 8.1 statistics software (Statistix, USA). NO production was evaluated using one-way analysis of variance followed by comparison with the RPMI medium-only group. Differences were considered significant at p < 0.01 and highly significant at p < 0.001.

Results

A. amurensis Fatty Acids Enhanced NO Production in RAW 264.7 Cells

In general, A. amurensis fatty acids were not toxic to RAW 264.7 cells; however, the fatty acids from the gonad and d-gland were toxic to the cells at high concentrations (2.5–4.0%), as assessed using a macrophage proliferation assay (data not shown). NO is a critical cellular signaling molecule that participates in immune regulation in physiological systems and is an important biomarker as an inflammatory mediator. NO production is stimulated by natural products, such as ginseng, to boost immunity [30]. To analyze the potential immune-enhancing effect of A. amurensis fatty acids, RAW 264.7 cells, which can produce NO, were used. As shown in Fig. 1, NO production in RAW 264.7 cells increased in a dose-dependent manner in response to 0.5–4.0% fatty acids from the three A. amurensis organs. In particular, the fatty acids from the d-gland induced substantial increases in NO production of more than 300% compared with that induced by skin and gonad fatty acids.

Figure 1. Effects of fatty acids from three organs of Asterias amurensis on nitric oxide production. # and * indicate a significant difference at p < 0.01 and p < 0.001, respectively, compared with cells treated with RPMI medium only. FA, fatty acids; DMSO, dimethyl sulfoxide.

A. amurensis Fatty Acids Enhanced Immune-Associated Gene Expression in RAW 264.7 Cells

In RAW 264.7 cells, the expression of most immune-associated genes was enhanced in a dose-dependent manner by the A. amurensis fatty acids. However, the expression of IL-6 was not affected by the different concentrations of A. amurensis fatty acids. The expression of COX-2 was highly increased by A. amurensis fatty acids. The expression of TNF-α was increased markedly by A. amurensis fatty acids from the skin and d-gland; however, the increase in TNF-α expression induced by the gonad fatty acids was lower than that induced by the other two organs. Inducible nitric oxide synthase (iNOS), a key enzyme that generates NO and plays an important role in immune regulatory conditions [31, 32], was highly expressed in response to gonad- and d-gland-derived fatty acids (Fig. 2), indicating that iNOS expression did not correlate completely with the results of NO production.

Figure 2. Quantification of immune-associated mRNAs by relative expression (fold) in RAW 264.7 cells treated with Asterias amurensis (A) skin-derived fatty acids, (B) gonadderived fatty acids, and (C) d-gland-derived fatty acids.

A. amurensis Fatty Acids Enhanced PGE2 Production in RAW 264.7 Cells

The immune-enhancing effects of A. amurensis fatty acids on RAW 264.7 cells were also determined by measuring the level of PGE2, which is an important pro-inflammatory factor (Fig. 3). The result showed that the production of PGE2 increased dose-dependently in RAW 264.7 cells treated with skin, gonad, and d-gland fatty acids. In addition, the levels of PGE2 in macrophage cells induced by d-gland and gonad fatty acids were higher than those induced by skin fatty acids, which was slightly different from the results for NO production. The produced PGE2 levels were much lower than those stimulated by LPS as a positive control. By contrast, the NO level in cells treated with d-gland fatty acids was similar to the level induced by the LPS control.

Figure 3. Quantification of PGE2 in RAW 264.7 cells treated with fatty acids from three organs of Asterias amurensis. # and * indicate a significant difference at p < 0.01 and p < 0.001, respectively, compared with cells treated with RPMI medium only. FA, fatty acids; DMSO, dimethyl sulfoxide.

A. amurensis Fatty Acids Enhanced Immunity through the MAPK and NF-κB Signaling Pathways in RAW 264.7 Cells

To investigate which immune signaling pathways contribute to A. amurensis fatty acid-induced immune enhancement in RAW 264.7 cells, the levels of NF-κB- and MAPK-associated proteins were analyzed via western blotting after treatment of RAW 264.7 cells with fatty acids from the three organs. Fig. 4 shows that A. amurensis fatty acids dose-dependently stimulated the phosphorylation of NF-κB p-65 in the NF-κB signaling pathway, whereas the level of IκBα was dose-dependently decreased. A. amurensis fatty acids also increased the phosphorylation of ERK1/2, JNK, and p38 in a dose-dependent manner. Interestingly, phosphorylation of NF-κB p-65 in RAW 264.7 cells was more pronounced after treatment with gonad and d-gland fatty acids, compared with that after treatment with skin fatty acids. Phosphorylation of p-38, ERK1/2, and JNK also increased to different levels depending on the source organ of the fatty acids. Fatty acids from d-glands induced the largest increase in phosphorylation of p-38, whereas those from the gonads caused the largest increase in JNK phosphorylation. Phosphorylation of ERK1/2 was increased to a greater extent by gonad and d-gland fatty acids compared with that induced by skin fatty acids.

Figure 4. Effect of Asterias amurensis fatty acids on the NF-κB and MAPK pathways in RAW264.7 cells, (A) Immunoblot of proteins from cells treated with Asterias amurensis skin-derived fatty acids. (B) Relative band intensity of proteins from cells treated with Asterias amurensis skin-derived fatty acids. (C) Immunoblot of proteins from cells treated with Asterias amurensis gonad-derived fatty acids. (D) Relative band intensity of proteins from cells treated with Asterias amurensis gonad-derived fatty acids. (E) Immunoblot of proteins from cells treated with Asterias amurensis d-gland-derived fatty acids. (F) Relative band intensity of proteins from cells treated with Asterias amurensis d-gland-derived fatty acids. FA, fatty acids; DMSO, dimethyl sulfoxide.

Discussion

A. amurensis and other starfish have been studied because of their diverse biological functional compounds [16], even though A. amurensis attacks mollusks and other echinoderms in the fishery industry [15]. However, to date, there has been no report about the immune-enhancing effect of fatty acids extracted from specific organs of A. amurensis on macrophages.

Immune cells such as macrophages are supplied with sufficient levels of glucose, amino acids, and fatty acids to maintain energy homeostasis and cellular processes [1]. These immune-associated cells are involved in acute and chronic inflammatory responses, including pain, fever, swelling, and tenderness [33, 34]. We confirmed the fatty acid profiles of three A. amurensis tissues and the cytotoxicity of these fatty acids in RAW 264.7 cells (data not shown). Our current results demonstrated immune-enhancing effects of the fatty acids on macrophages. The levels of NO and PGE2, which are important immune-regulatory biomarkers in macrophages, were increased according to the concentration of the fatty acids from all three organs (Figs. 1 and 3). The fatty acids from the three organs induced less PGE2 compared with that induced by the LPS positive control. By contrast, only the fatty acids from the d-gland induced NO secretion at a level comparable to that induced by LPS. These results suggested that the A. amurensis d-gland is a potentially important source of factors that can enhance NO production in macrophages.

We also investigated the expression of genes encoding immune-associated proteins (iNOS and COX-2) as well as those encoding cytokines (IL-1β, IL-6, and TNF-α), which are involved in proinflammatory regulation in activated macrophages [35]. The results showed that COX-2 expression increased markedly according to the concentration of A. amurensis fatty acids, and TNF-α expression was stimulated even at low concentrations of A. amurensis skin-derived fatty acids; however, its expression was further increased at high concentrations of fatty acids from the d-gland and gonad. In contrast, the expression of IL-6 did not show any difference depending on the concentration of the fatty acids. These results indicated that molecular regulation to activate the transcription of immune-associated genes might vary according to the source organ of the fatty acids in A. amurensis.

To regulate immune enhancement in RAW 264.7 cells, NF-κB p-65 and MAPK/ERK signaling molecules, such as ERK1/2, JNK, and p38, are coordinated via protein phosphorylation. NF-κB activity is modulated according its phosphorylation level and the degradation of associated proteins, such as p-65 and IκBα [36]. MAPK/ERK-associated proteins take part in the regulation of cell growth, differentiation, and cellular responses to cytokines and stresses [37]. Furthermore, MAPK is believed to control the NF-κB pathway and modulate the expression of inflammatory cytokines and the inflammatory process [38, 39]. The results of the present study demonstrated that fatty acids from A. amurensis organs activated the phosphorylation of the members of the NF-κB p-65 and MAPK pathways, such as ERK1/2, JNK, and p38, and thus promoted an immune response. These results indicated that fatty acids from A. amurensis enhanced immunity through the MAPK and NF-κB signaling pathways in RAW 264.7 cells. Moreover, the response varied depending on the source organ of the fatty acids, which suggested that the fatty acids from the three A. amurensis tissues might enhance the immune system through different cellular signaling pathways in RAW 264.7 cells [40, 41].

The results confirmed that A. amurensis contains potential immunity-enhancing fatty acids. The results will also aid our understanding of the mechanism of immune enhancement induced by A. amurensis fatty acids in macrophages.

Acknowledgments

This study was supported by the Marine Bio-Regional Specialization Leading Technology Development Program (D11413914H480000100), funded by the Ministry of Oceans and Fisheries in Korea.

Conflict of Interest


The authors have no financial conflicts of interest to declare.

Fig 1.

Figure 1.Effects of fatty acids from three organs of Asterias amurensis on nitric oxide production. # and * indicate a significant difference at p < 0.01 and p < 0.001, respectively, compared with cells treated with RPMI medium only. FA, fatty acids; DMSO, dimethyl sulfoxide.
Journal of Microbiology and Biotechnology 2018; 28: 349-356https://doi.org/10.4014/jmb.1709.09005

Fig 2.

Figure 2.Quantification of immune-associated mRNAs by relative expression (fold) in RAW 264.7 cells treated with Asterias amurensis (A) skin-derived fatty acids, (B) gonadderived fatty acids, and (C) d-gland-derived fatty acids.
Journal of Microbiology and Biotechnology 2018; 28: 349-356https://doi.org/10.4014/jmb.1709.09005

Fig 3.

Figure 3.Quantification of PGE2 in RAW 264.7 cells treated with fatty acids from three organs of Asterias amurensis. # and * indicate a significant difference at p < 0.01 and p < 0.001, respectively, compared with cells treated with RPMI medium only. FA, fatty acids; DMSO, dimethyl sulfoxide.
Journal of Microbiology and Biotechnology 2018; 28: 349-356https://doi.org/10.4014/jmb.1709.09005

Fig 4.

Figure 4.Effect of Asterias amurensis fatty acids on the NF-κB and MAPK pathways in RAW264.7 cells, (A) Immunoblot of proteins from cells treated with Asterias amurensis skin-derived fatty acids. (B) Relative band intensity of proteins from cells treated with Asterias amurensis skin-derived fatty acids. (C) Immunoblot of proteins from cells treated with Asterias amurensis gonad-derived fatty acids. (D) Relative band intensity of proteins from cells treated with Asterias amurensis gonad-derived fatty acids. (E) Immunoblot of proteins from cells treated with Asterias amurensis d-gland-derived fatty acids. (F) Relative band intensity of proteins from cells treated with Asterias amurensis d-gland-derived fatty acids. FA, fatty acids; DMSO, dimethyl sulfoxide.
Journal of Microbiology and Biotechnology 2018; 28: 349-356https://doi.org/10.4014/jmb.1709.09005

Table 1 . Sequences of oligonucleotide primers used to amplify immune-associated genes..

Gene nameAccession No.Nucleotide SequenceProduct size (bp)
iNOSBC062378.1F: TTCCAGAATCCCTGGACAAG
R: TGGTCAAACTCTTGGGGTTC
180
IL-1 βNM_008361.4F: GGGCCTCAAAGGAAAGAATC
R: TACCAGTTGGGGAACTCTGC
183
IL-6NM_031168.2F: AGTTGCCTTCTTGGGACTGA
R: CAGAATTGCCATTGCACAAC
191
COX-2NM_011198.4F: AGAAGGAAATGGCTGCAGAA
R: GCTCGGCTTCCAGTATTGAG
194
TNF-αD84199.2F: ATGAGCACAGAAAGCATGATC
R: TACAGGCTTGTCACTCGAATT
276
β-ActinNM_007393.5F: CCACAGCTGAGAGGAAATC
R: AAGGAAGGCTGGAAAAGAGC
193

References

  1. Walls J, Sinclair L, Finlay D. 2016. Nutrient sensing, signal transduction and immune responses. Semin. Immunol. 28: 396-407.
    Pubmed CrossRef
  2. Miccadei S, Masella R, Mileo AM, Gessani S. 2016. Omega3 polyunsaturated fatty acids as immunomodulators in colorectal cancer: new potential role in adjuvant therapies. Front. Immunol. 7: 486.
    CrossRef
  3. Roche HM. 1999. Unsaturated fatty acids. Proc. Nutr. Soc. 58: 397-401.
    Pubmed CrossRef
  4. Ford JH. 2010. Saturated fatty acid metabolism is key link between cell division, cancer, and senescence in cellular and whole organism aging. Age (Dordr.) 32: 231-237.
    Pubmed KoreaMed CrossRef
  5. Volpe JJ, Vagelos PR. 1976. Mechanisms and regulation of biosynthesis of saturated fatty acids. Physiol. Rev. 56: 339-417.
    Pubmed CrossRef
  6. Zock PL, Blom WA, Nettleton JA, Hornstra G. 2016. Progressing insights into the role of dietary fats in the prevention of cardiovascular disease. Curr. Cardiol. Rep. 18: 111.
    Pubmed KoreaMed CrossRef
  7. Fasano E, Serini S, Cittadini A, Calviello G. 2015. Longchain n-3 PUFA against breast and prostate cancer: which are the appropriate doses for intervention studies in animals and humans? Crit. Rev. Food Sci. Nutr. 57: 2245-2262.
    Pubmed CrossRef
  8. Zheng JS, Huang T, Yang J, Fu YQ, Li D. 2012. Marine N-3 polyunsaturated fatty acids are inversely associated with risk of type 2 diabetes in Asians: a systematic review and meta-analysis. PLoS One 7: e44525.
    Pubmed KoreaMed CrossRef
  9. Massey KA, Nicolaou A. 2011. Lipidomics of polyunsaturatedfatty-acid-derived oxygenated metabolites. Biochem. Soc. Trans. 39: 1240-1246.
    Pubmed CrossRef
  10. Nicolaou A. 2013. Eicosanoids in skin inflammation. Prostaglandins Leukot. Essent. Fatty Acids 88: 131-138.
    Pubmed CrossRef
  11. Wolfe LS. 1982. Eicosanoids: prostaglandins, thromboxanes, leukotrienes, and other derivatives of carbon-20 unsaturated fatty acids. J. Neurochem. 38: 1-14.
    Pubmed CrossRef
  12. Calder PC. 2013. Omega-3 polyunsaturated fatty acids and inflammatory processes: nutrition or pharmacology? Br. J. Clin. Pharmacol. 75: 645-662.
    Pubmed KoreaMed CrossRef
  13. Davidson J, Rotondo D, Rizzo MT, Leaver HA. 2012. Therapeutic implications of disorders of cell death signalling: membranes, micro-environment, and eicosanoid and docosanoid metabolism. Br. J. Pharmacol. 166: 1193-1210.
    Pubmed KoreaMed CrossRef
  14. Greene ER, Huang S, Serhan CN, Panigrahy D. 2011. Regulation of inflammation in cancer by eicosanoids. Prostaglandins Other Lipid Mediat. 96: 27-36.
    Pubmed KoreaMed CrossRef
  15. Shah AK, Kinoshita M, Kurihara H, Ohnishi M, Takahashi K. 2008. Glycosylceramides obtain from the starfish Asterias amurensis Lütken. J. Oleo Sci. 57: 477-484.
    Pubmed CrossRef
  16. Dong G, Xu T, Yang B, Lin X, Zhou X, Yang X, et al. 201 1. Chemical constituents and bioactivities of starfish. Chem. Biodivers. 8: 740-791.
    Pubmed CrossRef
  17. D'Orazio N, Gammone MA, Gemello E, De Girolamo M, Cusenza S, Riccioni G. 2012. Marine bioactives: pharmacological properties and potential applications against inflammatory diseases. Mar. Drugs 10: 812-833.
    Pubmed KoreaMed CrossRef
  18. Mayer AM, Hamann MT. 2005. Marine pharmacology in 2001-2002: marine compounds with anthelmintic, antibacterial, anticoagulant, antidiabetic, antifungal, anti-inflammatory, antimalarial, antiplatelet, antiprotozoal, antituberculosis, and antiviral activities; affecting the cardiovascular, immune and nervous systems and other miscellaneous mechanisms of action. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 140: 265-286.
    Pubmed KoreaMed CrossRef
  19. Higuchi R, Inoue S, Inagaki K, Sakai M, Miyamoto T, Komori T, et al. 2006. Biologically active glycosides from asteroidea, 42. Isolation and structure of a new biologically active ganglioside molecular species from the starfish Asterina pectinifera. Chem. Pharm. Bull. (Tokyo) 54: 287-291.
    Pubmed CrossRef
  20. Han YH, Ham JH, Lee NJ, Park CH, Shin YH, Lee DU. 2000. Antimutagenic activity of 5alpha-cholest-7-en-3beta-ol, a new component from the starfish Asterina pectinifera. Biol. Pharm. Bull. 23: 1247-1249.
    Pubmed CrossRef
  21. Peng Y, Zheng J, Huang R, Wang Y, Xu T, Zhou X, et al. 2010. Polyhydroxy steroids and saponins from China Sea starfish Asterina pectinifera and their biological activities. Chem. Pharm. Bull. (Tokyo) 58: 856-858.
    Pubmed CrossRef
  22. Hossain Z, Kurihara H, Hosokawa M, Takahashi K. 2006. Docosahexaenoic acid and eicosapentaenoic acid-enriched phosphatidylcholine liposomes enhance the permeability, transportation and uptake of phospholipids in Caco-2 cells. Mol. Cell. Biochem. 285: 155-163.
    Pubmed CrossRef
  23. Li G, Sinclair AJ, Li D. 2011. Comparison of lipid content and fatty acid composition in the edible meat of wild and cultured freshwater and marine fish and shrimps from China. J. Agric. Food Chem. 59: 1871-1881.
    Pubmed CrossRef
  24. Koftayan T, Milano J, D'Armas H, Salazar G. 2011. Lipid and fatty acid profile of Perna viridis, green mussel (Mollusca: Bivalvia) in different areas of the Eastern Venezuela and the West Coast of Trinidad. Rev. Biol. Trop. 59: 171-182.
    Pubmed CrossRef
  25. Garces R, Mancha M. 1993. One-step lipid extraction and fatty acid methyl esters preparation from fresh plant tissues. Anal. Biochem. 211: 139-143.
    Pubmed CrossRef
  26. Park WJ, Kothapalli KS, Lawrence P, Tyburczy C, Brenna JT. 2009. An alternate pathway to long-chain polyunsaturates: the FADS2 gene product delta8-desaturates 20:2n-6 and 20:3n-3. J. Lipid Res. 50: 1195-1202.
    Pubmed KoreaMed CrossRef
  27. Cao RA, Lee Y, You S. 2014. Water soluble sulfated-fucans with immune-enhancing properties from Ecklonia cava. Int. J. Biol. Macromol. 67: 303-311.
    Pubmed CrossRef
  28. Green LC, Wagner DA, Glogowski J, Skipper PL, Wishnok JS, Tannenbaum SR. 1982. Analysis of nitrate, nitrite, and [15N]nitrate in biological fluids. Anal. Biochem. 126: 131-138.
    Pubmed CrossRef
  29. Narayanan BA, Narayanan NK, Simi B, Reddy BS. 2003. Modulation of inducible nitric oxide synthase and related proinflammatory genes by the omega-3 fatty acid docosahexaenoic acid in human colon cancer cells. Cancer Res. 63: 972-979.
    Pubmed
  30. Kang S, Min H. 2012. Ginseng, the 'immunity boost': the effects of Panax ginseng on immune system. J. Ginseng Res. 36: 354-368.
    Pubmed KoreaMed CrossRef
  31. Lechner M, Lirk P, Rieder J. 2005. Inducible nitric oxide synthase (iNOS) in tumor biology: the two sides of the same coin. Semin. Cancer Biol. 15: 277-289.
    Pubmed CrossRef
  32. Surayot U, Wang J, Lee JH, Kanongnuch C, Peerapornpisal Y, You S. 2015. Characterization and immunomodulatory activities of polysaccharides from Spirogyra neglecta (Hassall) Kutzing. Biosci. Biotechnol. Biochem. 79: 1644-1653.
    CrossRef
  33. Olefsky JM, Glass CK. 2010. Macrophages, inflammation, and insulin resistance. Annu. Rev. Physiol. 72: 219-246.
    Pubmed CrossRef
  34. Hu SS, Bradshaw HB, Chen JS, Tan B, Walker JM. 2008. Prostaglandin E2 glycerol ester, an endogenous COX-2 metabolite of 2-arachidonoylglycerol, induces hyperalgesia and modulates NFkappaB activity. Br. J. Pharmacol. 153: 1538-1549.
    Pubmed KoreaMed CrossRef
  35. Zhao Y, Liu J, Liu C, Zeng X, Li X, Zhao J. 2016. Anti-inflammatory effects of p-coumaric acid in LPS-stimulated RAW264.7 cells: involvement of NF-κB and MAPKs pathways. Med. Chem. 6: 327-330.
    CrossRef
  36. Baeuerle PA, Baltimore D. 1996. NF-kappa B: ten years after. Cell 87: 13-20.
    Pubmed CrossRef
  37. Kim JB, Han AR, Park EY, Kim JY, Cho W, Lee J, et al. 2007. Inhibition of LPS-induced iNOS, COX-2 and cytokines expression by poncirin through the NF-kappaB inactivation in RAW 264.7 macrophage cells. Biol. Pharm. Bull. 30: 2345-2351.
    Pubmed CrossRef
  38. Cargnello M, Roux PP. 2011. Activation and function of the MAPKs and their substrates, the MAPK-activated protein kinases. Microbiol. Mol. Biol. Rev. 75: 50-83.
    Pubmed KoreaMed CrossRef
  39. Li YY, Hsieh LL, Tang RP, Liao SK, Yeh KY. 2009. Interleukin-6 (IL-6) released by macrophages induces IL-6 secretion in the human colon cancer HT-29 cell line. Hum. Immunol. 70: 151-158.
    Pubmed CrossRef
  40. Allam-Ndoul B, Guenard F, Barbier O, Vohl MC. 2016. Effect of n-3 fatty acids on the expression of inflammatory genes in THP-1 macrophages. Lipids Health Dis. 15: 69.
    Pubmed KoreaMed CrossRef
  41. Yang SC, Sung PJ, Lin CF, Kuo J, Chen CY, Hwang TL. 2014. Anti-inflammatory effects of secondary metabolites of marine Pseudomonas sp. in human neutrophils are through inhibiting P38 MAPK, JNK, and calcium pathways. PLoS One 9: e114761.
    Pubmed KoreaMed CrossRef