The gram-negative bacteria Xanthomonas oryzae pv. oryzae (Xoo) causes a bacterial leaf blight in rice plants [1]. It is a devastating disease in rice, which reduces grain yield up to 30% when the damage is serious. Xoo enters into leaf tissues through wounds or hydathodes of rice plants and migrates to the xylem to proliferate [2].

Xoo causes virulence through enzymatic and non-enzymatic mechanisms [3]. For examples, biofilm is one of the most common virulence factors of various microorganisms and helps bacteria adhere to each other [4, 5]. This biofilm also contributes to the attachment of the bacteria to xylem [6]. Therefore inhibiting the formation of biofilm has become a strategy to control pathogenic microorganisms [7]. Pectinase, an extracellular enzyme, induces host defense responses [8]. Xanthan of a large amount of exopolysaccharide (EPS) from Xanthomonas spp. is a well-known virulence factor [9, 10]. The type III secretion system causes cell death at the plant infection site [11, 12]. Quorum sensing (QS) causes coordinated biofilm formation and increases virulence through motility, chemotaxis, of stress response, and synthesis EPS and extracellular enzymes [13-15].

Terpenoids are most abundant compounds among plant secondary metabolites. Limonene is a cyclic monoterpene (C10) found mainly in the oil of citrus fruit peels and D-isomer is commonly found in nature as a fragrance [16]. In our previous study, we revealed that abiotic stresses such as hydrogen peroxide, UV-B radiation, and γ-irradiation strongly induced the production of volatile monoterpene limonene in rice seedlings. We further confirmed that the limonene was able to strongly suppress the growth of Xoo in a disc diffusion assay and in vivo infection assay [17]. Interestingly, the degree of antimicrobial activity was dependent on a chirality of the compounds of which (S)-limonene showed higher antimicrobial activity than that of (R)-enantiomer.

It is known that carveol, a limonene oxidation derivative, has antibacterial activity against Staphylococcus aureus, Salmonella enterica serovar Typhimurium, Escherichia coli, and Bacillus cereus using microdilution method [18]. D-Limonene was found to have antibacterial activity against Salmonella senftenberg, E. coli, S. aureus, and Pseudomonas species by comparing growth inhibition rates in nutrient broth [19]. It also has an antifungal effect through weakening the cell wall of Saccharomyces cerevisiae [20]. Carveol and D-limonene have been actively studied to evaluate their antibacterial activity against human pathogens, but the research with plant pathogens has been limited. Moreover, little is known about differential effect derived from isomeric properties of limonenes (e.g., D-limonene and L-limonene) on the antimicrobial activity.

In this study, we report the inhibitory effect of limonene isomers and its oxidation derivative carveol on the growth of Xoo in a dose-dependent manner. The mechanism of the inhibition was investigated by performing crystal violet assay, motility assay, and xanthomonadin quantification. A field emission-scanning electron microscopy revealed that the monoterpenoids cause severe morphological changes of Xoo. Further, we confirmed the differential expression of the genes involved in the virulence and biofilm formation of Xoo with the treatment of the terpenoids.

Measurement of Inhibition Effect in Liquid Cultures

Xoo culture (OD₆₀₀ = 1.0, 2 ml) was inoculated into 10 ml of nutrient broth (NB) (BD Difco, USA) with or without a compound in various concentrations (0.1, 0.4, 0.7, 1, 2, 4, 6, 8, or 10 mM). After incubation for 48 h in a shaking incubator at 28°C, OD₆₀₀ was measured and growth rates were compared for each compound concentration.

Evaluation of Motility

Motility of Xoo was evaluated after the treatment of various concentrations of a compound through swarming and swimming characteristics. Each compound dissolved in DMSO was added to sterilized swarming (NB, 0.5%agar) and swimming media (NB, 0.3% agar), respectively, and solidified in a petri-dish. Xoo culture (5 μl droplet) was added on each plate and incubated for 7 days at 28°C. Each plate was evaluated for swimming and swarming by measuring the diameter of the bacterial zone.

Detection of Biofilm Using Crystal Violet Assay

Crystal violet assay was performed to detect the biofilm of Xoo grown using brain heart infusion (BHI) broth (BD Difco) supplemented with 5% (w/v) sucrose. Each compound in various concentrations was added to the medium and 100 μl aliquot was transferred into each well of a 96-well cell culture plate. Then, 20 μl of Xoo culture was inoculated into the wells and incubated without shaking for 7 days at 28°C. After the incubation, each well was washed three times using deionized water (DIW) and stained with 200 μl of 0.1% (w/v) crystal violet solution for 15 min. Sequentially, each well was washed three times using DIW and air dried. Crystal violet was dissolved with 100% ethanol for 15 min and biofilm was measured at OD₅₉₀.

Estimation of Extracted Xanthomonadin

Cell pellets collected from 4 ml of Xoo suspension with or without a compound was mixed with 1 ml 100%methanol. The mixture was further incubated in darkness for 10 min on a rotating shaker and the cells were collected by centrifugation at 12,000 g for 8 min. The xanthomonadin pigment from the collected supernatant was measured at OD₄₄₅ [21, 22].

Field Emission-Scanning Electron Microscope (FE-SEM) Observation

Xoo was incubated in NB medium with or without a compound at 28°C shaking incubator for 12 h. The cultures were centrifuged and suspended in 2% paraformaldehyde and 2% glutaraldehyde in 0.05 M sodium carcodylate buffer (pH 7.2). The suspensions were incubated (pre-fixation) at 4°C overnight and then were washed three times with 0.05 M sodium carcodylate buffer (pH 7.2). The suspension was further incubated (post-fixation) for 1.5 h in 1% osmium tetroxide. Then, the suspension was dehydrated by ethanol gradient ranging from 30% to 100% for 3 min incubation. After the dehydration, hexamethyldisilazane (100%) was added and the cells were dried at room temperature. Images were taken at magnifications of × 10,000 and × 40,000 using SUPRA-40VP (Zeiss Germany) equipment.

Real-Time PCR

Gene specific primers for virulence and biofilm formation were designed using Primer 3 (version 0.4.0) templating the gene sequences available in the NCBI (Table 1). Xoo cultures incubated NB medium with or without a compound were lysed using TRI reagent (Molecular Research Center, Inc., USA). The RNA was isolated with chloroform and precipitated with isopropanol. RNeasy mini kit (Qiagen, USA) was used to wash column-based isolated RNA. During washing, genomic DNA was removed with RNase-Free DNase Set (Qiagen). For cDNA synthesis, the RT series (Biofact, Republic of Korea) was performed according to the manufacturer’s procedure. Real-time PCR was performed with 2X Real-Time PCR Master Mix (Biofact) according to the manufacturer’s instructions. The PCR cycle consisted of the following steps: 15 minutes at 95°C and 40 cycles of 20 s at 95°C and 30 s at 58°C. The expression level of 16S rRNA was used to determine the relative expression level of target genes. The relative expression level of each gene was calculated by 2^-ΔΔCt method [23].

Table 1 . Primer list used for real-time PCR..

Gene	Primer sequence		Reference
	Forword	Reverse
avrXa7 / pthXo1	GAGAGCATTGTTGCCCAGTT	CGGCGATTGATTCTTCTGAT
avrXa10	CGTGATGTGGGAACAAGATG	GTGTTGTAGAGGGCGACGAT
pthXo6	TCAGCAGCAGCAAGAGAAGA	CAACGCCCTGATTATGTCCT	This study
pthXo7	GGCTTGGTACAGCTCTTTCG	GTCTGATCTCCCTCGTGCAT
hrpG	ACTCAGCGTTGGTCCATACC	TGCGCAGCTTGTAGATATGC
pglA	TCGCTGGGTTCCAAGGCATT	GGCTTTGCGAACGAGACCTTT
pmt	TGTTCGACAATGCCCTCATCC	GCCACAAAGCGGCTATTGATCG	[8]
pel	TGCGTTTCGGTAAGGTGCATCT	ACCGCTGATCTCGAACACATTACG
pelL	GCGCATCGAAATGATCAACC	TCGTCCAGGCTGACGAAAT
gumB	ATCGTGTTCCGCATGGTC	ATATCGCCGCCGTAAATCTC
gumD	GCGTGCGATTCGTATGTTTC	GCGAGGAAGCTGTGTAAGT
gumG	GCCAATGGTTCACGTCTGTA	GCACGCAAGGCAATGTAAG	[21]
gumM	TGTTGAGACGACGGGAATTG	CTGCCAACGCATGGAATAGA
rpfG	GACGAGATGAGCGTGATGAA	GATAACCGGTGCCGTCATAA
rpfB	ACGCGGTGAAGCGGGTCTTT	ATCACTGCGCTGCCGCTGTA

Statistical Analysis

Each experiment was performed in three technical replicates and three biological replicates. The results obtained from each experiment were expressed as mean and standard deviation (SD) in triplicate. The significance of the control group and each experimental group was compared using the Dunnett test after analysis of variance after one-way ANOVA at the p < 0.05 level (*p < 0.05, **p < 0.01, and ***p < 0.001). Statistical analysis was performed using GraphPad Prism5 (ver.5.0, USA).

Measurement of Inhibition Effect in Liquid Cultures

It was confirmed that the growth of Xoo treated with carveol was significantly inhibited at 0.1 mM, and no growth was observed at ≥ 1 mM (Fig. 1A). However, D-limonene and L-limonene treatments cause the significant growth inhibition at as high as 10 mM (Fig. 1B and 1C).

Figure 1. Measurement of bacterial growth rate calculated with OD₆₀₀ of Xoo incubated in NB media treated with or without compounds for 48 h. (A) Carveol, (B) D-Limonene, and (C) L-Limonene.

Evaluation of Motility

As a result of swarming, it was confirmed that the bacterial zone of Xoo treated with carveol was inhibited starting from 0.1 mM and Xoo did not grow starting at ≥ 0.7 mM (Fig. 2A). Swimming results were also similar to those of swarming results (Fig. 2D). D-Limonene seemed to reduce the zone area in a concentration-dependent manner in the swarming analysis, and no growth of Xoo was observed at 10 mM (Fig. 2B). On the other hand, in the swimming results, there was negligible inhibition effect at 0.1 mM up to 8 mM, but with complete suppression at 10 mM (Fig. 2E). For L-limonene, the zone of motility of Xoo was smaller than that of Xoo without the compound in both swarming and swimming results, but the level of the inhibitory activity was lower when compared to that of D-limonene representing considerable Xoo growth even at 10 mM treatment (Fig. 2C and 2F).

Figure 2. Result of motility evaluation through swarming and swimming level by measuring diameter of bacterial zone grown on swarming (NB, 0.5% agar) and swimming (NB, 0.3% agar) media added compounds. (A-C) Swarming analysis result, sequentially carveol, D-limonene, and L-limonene, (D-F) Swimming analysis result, sequentially carveol, D-limonene, and L-limonene.

Detection of Biofilm using Crystal Violet Assay

Xoo culture treated with carveol at different concentrations showed a tendency to decrease biofilm production at 0.1 mM (≥ 20% suppression) to 0.4 mM (≥ 50% suppression) compared to that of the control (Fig. 3A). With the treatment of ≥ 0.7 mM carveol, the biofilm production was dramatically reduced (≥ 90% suppression). D-Limonene and L-limonene treatments also reduced biofilm formation of Xoo in a concentration-dependent manner, but the degree of effect was lower than that of carveol. D-Limonene and L-limonene treatments with as high as 10 mM still showed ≈ 40% of biofilm formation in comparison with that of control (Fig. 3B and 3C).

Figure 3. Comparative analysis of biofilm formation rate by measuring OD₅₉₀ from a result of crystal violet assay after 7 days incubation without (control) or with treatment of various concentrations of each compound. (A) Carveol, (B) D-Limonene, and (C) L-Limonene.

Estimation of Extracted Xanthomonadin

Carveol significantly reduced the production of xanthomonadin at 0.4 mM and basal level of xanthomonadin was produced at ≥ 0.7 mM treatment (Fig. 4A). However, D-limonene and L-limonene treatments did not make significant changes in the production of xanthomonadin and the degree of change was also similar with two limonene isomers (Fig. 4B and 4C).

Figure 4. Estimation of extracted xanthomonadin by analyzing OD₄₄₅ resulting from reacting cell pellet of Xoo treated compounds with 100% methanol. (A) Carveol, (B) D-Limonene, and (C) L-Limonene.

Field-Emission-Scanning Electron Microscope (FE-SEM) Observation

We employed two different concentrations for the treatments of compounds in the Xoo culture prior to FE-SEM observation based on the results in Fig. 1. Xoo culture was treated with carveol at 0.7 mM of sub-minimal inhibitory concentration (MIC). Both D-limonene and L-limonene were used at 10 mM, the highest concentration employed in this study. Xoo cells treated with all three compounds showed similar ultrastructural changes with severe damages on their surface (Table 2). Specifically, many pore-like morphology was observed. The surface of the cells was wrinkled and shrunk with slight fold. Overall, the most cell population had severe morphological changes with the treatment of carveol and the less cells were damaged with the two limonene treatments. As a note, some cells with the treatment of L-limonene showed acute destruction in the morphology (Table 2).

Table 2 . Morphology observation of Xoo treated without (control) or with compounds through FE-SEM..

This analysis was treated 0.7 mM carveol, 10 mM D-limonene, and 10 mM L-limonene. 10K = 10,000, 40K = 40,000..

Real-Time PCR

The expression level of genes that are known for virulence and biofilm formation of Xoo was analyzed and compared after the treatment of carveol (0.7 mM). All genes except gumM employed were significantly down-regulated in their transcription level compared to that of control (Fig. 5A). In addition, D-limonene treatment (10 mM) decreased the relative expression levels of all target genes except pmt and pel compared to control levels but to a lesser extent (Fig. 5B). Unexpectedly, we did not find any significant changes in transcription levels of the target genes with the L-limonene (10 mM) treatment (Fig. 5C).

Figure 5. Quantification of relative expression level of virulence and biofilm gene using real-time PCR. This analysis was treated 0.7 mM carveol, 10 mM D-limonene, and 10 mM L-limonene. (A) Carveol, (B) D-Limonene, and (C) LLimonene.

Plant natural products such as alkaloids, flavonoids, glycosides, terpenes, tannins, and polyphenols have potential as new agents to combat bacterial infections caused by various virulence factors. Phytochemicals interrupt QS by interfering with the signal molecules and receptors that cause bacterial QS [24, 25]. They inhibit biofilm formation by preventing the adhesion of bacteria and killing bacteria in mature biofilm [26]. Swarming and swimming ability of bacteria are restricted by reduced expression of the genes that are related with flagella and motility affected by a functionality of the natural products [27-29]. The plant phytochemicals inhibit the production of bacterial pigments and the activities of various enzymes (e.g., sortases, proteases, coagulase, etc.) [25]. They also facilitate inhibition of the surfactants secreted by bacteria [30, 31]. The present study demonstrated the antibacterial effect of limonenes and its oxidation derivative. We revealed that carveol treatment significantly inhibited Xoo growth and the antimicrobial activity of D-limonene and L-limonene was to a lesser degree showing considerable suppression of Xoo growth at the highest concentration tested (10 mM). Therefore, we concluded that hydroxyl-containing carveol has higher antimicrobial activity than limonene isomers against Xoo growth. To examine minimal concentration of the isomers for complete inhibition of Xoo growth, further experiments should be performed with higher concentrations of D-limonene and L-limonene (> 10 mM).

Bacteria can swim in liquid and on solid surfaces through their flagella, which is the most common means of bacterial motility [32, 33]. Bacterial motility is an essential factor contributing to bacterial attachment and biofilm formation [34, 35]. Melatonin and thyme oil reduced Xoo motility [22, 36]. Microorganisms acquire resistance to antimicrobial agents through various methods, and biofilm formation is one such method. Limonene was confirmed to inhibit biofilm formation of Bacillus cereus, E. coli, and Pichia anomala [37]. Limonene has been demonstrated to be effective in inhibiting biofilm formation. In the present study, the crystal violet assay was performed to examine whether limonene isomers and carveol treatment can inhibit biofilm production. An assay using crystal violet as a proxy marker can quantify biofilm formation by using an indirect method [38]. Xanthomonadin is a yellow pigment found in a membrane to protect bacterial cells from photodamage and peroxidation maintaining a close relationship with the host plant [39]. Additionally, it has been reported that xanthomonadin is involved in biofilm formation [40]. Carveol-treated Xoo exhibited a decrease in motility, biofilm formation, and xanthomonadin production compared with the untreated Xoo. The results were in the same line with the antimicrobial activities of carveol shown in Fig. 1. Notably, carveol treatment resulted in dramatic decrease in the assays above mentioned, but both limonene isomers had activities to a lesser extent. Also, isomeric difference of limonenes did not confer any differential activities on motility, biofilm formation, and xanthomonadin production of Xoo.

Most antibiotic treatments cause destructive damages such as roughening, shriveling, shrinking, and holes in bacterial cell membranes [41, 42]. Similarly, it is reported that limonene treatment destroyed the cell membrane of multidrug resistant E. coli causing cell death [43]. Treatment of an antihelminth drug niclosamide changed Xoo into an irregular shape with hollow surfaces [21]. However, limonenes and carveol treatment in this study destroyed Xoo cell membranes causing devasting changes in the ultrastructual morphology.

The expression levels of virulence genes that induce Xoo to cause pathogenicity in rice and the genes involved in biofilm formation were quantified using real-time PCR. Among the virulence genes analyzed, avrXa7 influences bacterial aggressiveness and disease symptom development and suppresses the hypersensitive response (HR). avrXa10 inhibits the HR response. pthXo1 induces the expression of Os8N3, a rice susceptibility gene. pthXo6 targets the transcription factor OsTFX1. pthXo7 influences on the bacterial growth and lesion length of Xoo with reduced virulence [3]. hrpG is essential for the expression of the hrp gene, which encodes the type III secretion system [11, 12]. pglA encodes polygalacturonase that degrades pectin [8]. The gumBCDEFGHIJKLM gene involved in biofilm formation regulates xanthan synthesis [10, 42-44]. rpfG is involved in QS and regulates virulence factors [45, 46]. Carveol and D-limonene downregulated the expression levels of genes analyzed in this study. Although there was a difference in the expression level between treated and untreated Xoo, the degree of decrease was not dramatic. Further study should consider higher concentrations of the compounds and the time points to be analyzed.

We here investigated the effects of limonenes and its oxidation derivative on Xoo growth. Carveol significantly affected the antibacterial activity, virulence, and biofilm formation of Xoo even at as low as 0.1 mM concentrations. It remarkably changed the morphology of Xoo cells and reduced the expression levels of virulence and biofilm formation-related genes. Although D-limonene and L-limonene exhibited a minor effect at the concentrations analyzed, we assumed that if higher concentrations are employed, the effect would be more definite to a greater extent. Together, the limonenes and carveol may be considered as an eco-friendly antimicrobial agent, with which we can reduce the use of synthetic chemicals that are harmful to human health and ecosystem. Formulations and relative compositions of the compounds should also be an interest to enhance the functionality.

This work was supported by Korea Institute of Planning and Evaluation for Technology in Food, Agriculture and Forestry (IPET) through Crop Viruses and Pests Response Industry Technology Development Program, funded by Ministry of Agriculture, Food and Rural Affairs (MAFRA) (321102-03-1-CG000).

Hyeonbin Kim: Formal analysis, investigation, methodology, writing – original draft, and visualization, Mi Hee Kim: Formal analysis, investigation, and methodology, Ui-Lim Choi: Investigation, Moon-Soo Chung: Formal analysis, and investigation, Chulho Yun: Investigation, Youngkun Shim: Resources, Jaejun Oh: Resources, Sungbeom Lee: Project administration, and writing – review & editing, Gun Woong Lee: Project administration, and writing – review & editing

The authors have no financial conflicts of interest to declare.