JMB

eISSN 1738-8872
pISSN 1017-7825

Table. 1.

Table. 1.

Primer sequences used for quantification of gene expression.

Gene Primer sequence (5'→ 3')
Human EGF F CAGGGAAGATGACCACCACT
R CAGTTCCCACCACTTCAGGT
Human HB-EGF F ACAAGGAGGAGCACGGGAAAAG
R CGATGACCAGCAGACAGACAGATG
Human FGF-4 F GGGAGTCTACAGACAGCAAG
R GAGCCTAGGGTGTGGTTTA
Human FGF-6 F GGGAGTCTACAGACAGCAAG
R GAGCCTAGGGTGTGGTTTA
Human ALPL F ATTGACCACGGGCACCAT
R CTCCACCGCCTCATGCA
Human SHH F GCGCCAGCGGAAGGTAT
R CCGGTGTTTTCTTCATCCTTAAA
Human FGF7 F ATCAGGACAGTGGCAGTTGGA
R AACATTTCCCCTCCGTTGTGT
Human BMP-2 F GAGGTCCTGAGCGAGTTCGA
R TCTCTGTTTCAGGCCGAACA
J. Microbiol. Biotechnol. 2024;34:17~28 https://doi.org/10.4014/jmb.2308.08013
© J. Microbiol. Biotechnol.