JMB

eISSN 1738-8872
pISSN 1017-7825

Table. 1.

Table. 1.

Primer sequences.

Gene Forward (5′→3′) Reverse (5′→3′)
COL2A1 TCT ACCCCAATCCAGCAAAC GTTGGGAGCCAGATTGTCAT
ACAN TGTGGGACTGAAGTTCTTGG AGCGAGTTGTCATGGTCTG
J. Microbiol. Biotechnol. 2021;31:1401~1408 https://doi.org/10.4014/jmb.2108.08027
© J. Microbiol. Biotechnol.