JMB

eISSN 1738-8872
pISSN 1017-7825

Table. 1.

Table. 1.

Strains, plasmids, and primers.

Strain/plasmid/primer Description
Bacterial strain
EPEC001 Wild-type strain
EPEC001ΔOAg Deletion of the entire O-antigen gene cluster, Cmr
EPEC001Δwzy Deletion of the wzy gene, Cmr
EPEC080 Wild-type strain
EPEC080ΔOAg Deletion of O-antigen gene cluster, Cmr
EPEC080Δwzy Deletion of the wzy gene, Cmr
Plasmid
pSim17 Plasmid carrying genes encoding lambda Red recombinase system, Bsr
pKD3 Template for PCR amplification of Red recombinase-medicated recombination, Cmr
Primer Nucleotide sequences (5'-3') a
FOAg001 ACATTTATTGAAACCAATATTGTTGGTACTTATGTCCTTTTGGAAGCCGCCATATGAATATCCTCCTTAG, forward primer for EPEC001 O-antigen gene cluster deletion
ROAg001 TATAAGCATCAAAACATATCCTAGCGGCTTTTACATTTCCAGTTAACATTGTGTAGGCTGGAGCTGCTTCG, reverse primer for EPEC001 O-antigen gene cluster deletion
Fwzy001 TTATTAAATATATGTTTATCAAGGCTTTCTACAAATCCTTTGATTTTATTCATATGAATATCCTCCTTAG, forward primer for EPEC001 wzy gene deletion
Rwzy001 ATCATTCCATAATATTAACCATATTAATGATACTACATAAGTATTAAAAGGTGTAGGCTGGAGCTGCTTCG, reverse primer for EPEC001 wzy gene deletion
FOAg080 CTGGCTGCTGAAAGCCATGTGGATCGTTCCATTACAGGCCCTGCGGCATTCATATGAATATCCTCCTTAG, forward primer for EPEC080 O-antigen gene cluster deletion
ROAg080 CTACCAGCAGCCACGGGATCATGCCGCTGTCGCAGTAAGCGAAATCACGGGTGTAGGCTGGAGCTGCTTCG, reverse primer for EPEC080 O-antigen gene cluster deletion
Fwzy080 TTGGCTTTTGCGTTTATTTCTATTTATTACAAGGCTAAGGCAATAAGGCTCATATGAATATCCTCCTTAG, forward primer for EPEC080 wzy gene deletion
Rwzy080 TAATTCACTCATGCGCAAAGAAAATGCTGGCACAAACGAAAATAAAACTAGTGTAGGCTGGAGCTGCTTCG, reverse primer for EPEC080 wzy gene deletion
Vcat ATGGACAACTTCTTCGCC, forward primer for each mutant verification, designed in cat gene of pKD3
VOAg001 ACGAGGCGTTTCAAGAGA, reverse primer for EPEC001ΔOAg verification, designed in gnd of EPEC001, 856bp
Vwzy001 GTTGGAAATAAATGGCTGTG, reverse primer for EPEC001Δwzy verification, designed in orf11 of EPEC001 O-AGC, 774bp
VOAg080 ACTAACCACTGGACTTGCTC, reverse primer for EPEC080ΔOAg verification, designed in gnd of EPEC080, 1002bp
Vwzy080 CCACTGTTGGCTTTTGTTT, reverse primer for EPEC080Δwzy verification, designed in orf12 of EPEC080 O-AGC, 867bp

aBoldface characters indicate the 50 nucleotides homologous to the initial and final portions of the target DNA segment.

J. Microbiol. Biotechnol. 2021;31:1191~1199 https://doi.org/10.4014/jmb.2105.05016
© J. Microbiol. Biotechnol.