JMB

eISSN 1738-8872
pISSN 1017-7825

Table. 3.

Table. 3.

Primers used for construction of an aprE with tandem P10 promoter.

Primers Sequences References
aprE3-5-np-F 5’-CTGGATCCTCTTAAAAGGAGAGGGTAAAGAATGAGAAGCA-3’’ This study
aprE3-5-R 5'- GCGAATTCGAGAACAGAGAAGCCGCT -3' 13
MagaP10-F 5’-AAGCTTCTAGAGATCTGCAGGTCGACGGGTTGACAAAAATATTATTCCATCTATTAAACTAAATTCACAGAATAGTCTTT -3’ This study
MagaP10-R 5’-TTTTAAGAGGATCCAGAGTAGACTTACTTAAAAGACTATTCTGTGAATTTAGTTTAATAGATGGAATAATATTTTTGTC -3’ This study
Maga2P10-F 5’-GGCGGAGCCTATGGAAAAACGCTTTGCCCTTGACAAAAATATTATTCCATCTATTAAACTAAGCTT -3’ This study
Maga2P10-R 5’-CCCGTCGACCTGCAGATCTCTAGAAGCTTAGTTTAATAGATGGAATAATATTTTTGTCAAGGGCAA-3’ This study

The restriction site was underlined: BamHI (forward primer) and EcoRI (reverse primer).The -35 and -10 promoter regions were in bold and underlined.

J. Microbiol. Biotechnol. 2021;31:833~839 https://doi.org/10.4014/jmb.2103.03027
© J. Microbiol. Biotechnol.