JMB

eISSN 1738-8872
pISSN 1017-7825

Table. 1.

Table. 1.

Primers used in this study.

Primers Sequences References
Restriction site -35 -10
aprE3-5-F 5’-CGCGGATCCGGGTCTACTAAAATATTATTCCATCTATTACAATAAATTC -3’ 13
Pcry3A-F 5’-CGCGGATCCGGGTTGCAAAAAATATTATTCCATCTATTAAGCTAAATTC -3’ 14
P10-F 5’-CGCGGATCCGGGTTGACAAAAATATTATTCCATCTATTAAACTAAATTC -3’ 15
PSG1-F 5’-CGCGGATCCGGGTTGACAAAAATATTATTCCATCTATTACAATAAATTC -3’ 16
PsrfA-F 5’-CGCGGATCCGGGGTGATAAAAATATTATTCCATCTATTAAACTAAATTC -3’ 17
aprE3-5-R 5'- GCGAATTCGAGAACAGAGAAGCCGCT -3' 13

The restriction site was underlined: BamHI (forward primer) and EcoRI (reverse primer).The -35 and -10 promoter regions were in bold and underlined.

J. Microbiol. Biotechnol. 2021;31:833~839 https://doi.org/10.4014/jmb.2103.03027
© J. Microbiol. Biotechnol.