JMB

eISSN 1738-8872
pISSN 1017-7825

Table. 2.

Table. 2.

Primers of MCLSA, LAMP and RT-PCR assays.

Name Primer ID Primers Sequence (5'-3') Nucleotide Length
MCLSA MsF1 GTTGTTTGCAGCTCTGTG-TCAGGACCCACAGGAG 34
MsR1 GGGCTTTTCGTTTCAGTA-AACGGTTTGTTGTATTGC 36
MsF2 CGTCGCAGTAACTGTTGCT-ACCCAGAAAGTTACCA 35
MsR2 GCAGCGTCATTGACAACGA-CATTTATCACATACAGCA 37
LinkAB CACAGAGCTGCAAACAACgggcccATGACTTTGCTTTTCGGG 42
LAMP[7] FIP TGGGGCACACAATTCCTAGT-CACACACGTAGACATTCGT 39
BIP TCAGAAACCATAATCTACCATGGC-ATTACATCCCGTACCCTCTT 44
F3 TCGGTTGTGCGTACAAAG 18
B3 AGCCTCTACATAAAACCATCC 21
LF CCCATTAACAGGTCTTCCAAAGT 23
LB CCTGCAGGTACCAATGGGG 19
RT-PCR[22] E6-F GAGAACTGCAATGTTTCAGGACC 23
E6-R TGTATAGTTGTTTGCAGCTCTGTGC 25
TaqMan probe CAGGAGCGACCCAGAAAGTTACCACAGTT 29
J. Microbiol. Biotechnol. 2021;31:610~620 https://doi.org/10.4014/jmb.2012.12047
© J. Microbiol. Biotechnol.