JMB

eISSN 1738-8872
pISSN 1017-7825

Table. 1.

Table. 1.

Information of primers and probes used in the study.

Institute Gene Name Type* Sequence (5’ → 3’) Taxon Ref.
CDC (USA) N 2019-nCoV_N1 F GACCCCAAAATCAGCGAAAT SARS-CoV-2 [37]
R** TCTGGTTACTGCCAGTTGAATCTG
P+ ACCCCGCATTACGTTTGGTGGACC
2019-nCoV_N2 F TTACAAACATTGGCCGCAAA SARS-CoV-2
R GCGCGACATTCCGAAGAA
P ACAATTTGCCCCCAGCGCTTCAG
NIID (Japan) NIID_2019-nCoV_N F AAATTTTGGGGACCAGGAAC SARS-CoV-2
R TGGCAGCTGTGTAGGTCAAC
P ATGTCGCGCATTGGCATGGA
NIH (Thailand) WH-NIC N-R F CGTTTGGTGGACCCTCAGAT SARS-CoV-2
R CCCCACTGCGTTCTCCATT
P CAACTGGCAGTAACCA
HKU (Hong Kong) HKU-N F TAATCAGACAAGGAACTGATTA Sarbeco
R CGAAGGTGTGACTTCCATG
P GCAAATTGTGCAATTTGCGG
Charité (Germany) E E_Sarbeco F ACAGGTACGTTAATAGTTAATAGCGT Sarbeco [41]
R ATATTGCAGCAGTACGCACACA
P ACACTAGCCATCCTTACTGCGCTTCG
University of Bonn Medical Centre (Germany) upE F GCAACGCGCGATTCAGTT MERS-CoV [38]
R GCCTCTACACGGGACCCATA
P CTCTTCACATAATCGCCCCGAGCTCG
University of Leuven (Belgium) OC43 F ATGTTAGGCCGATAATTGAGGACTAT HCoV-OC43 [39]
R AATGTAAAGATGGCCGCGTATT
P CATACTCTGACGGTCACAAT

*F: forward primer, R: reverse primer, P: Probe

J. Microbiol. Biotechnol. 2021;31:358~367 https://doi.org/10.4014/jmb.2009.09006
© J. Microbiol. Biotechnol.